ID: 1176008920

View in Genome Browser
Species Human (GRCh38)
Location 20:62881288-62881310
Sequence GTTTGACGCCTGGCTGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176008899_1176008920 28 Left 1176008899 20:62881237-62881259 CCCCTCACCGGTCTCAGTGGCCA 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008903_1176008920 21 Left 1176008903 20:62881244-62881266 CCGGTCTCAGTGGCCAGGCGCCT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008911_1176008920 -4 Left 1176008911 20:62881269-62881291 CCTGCCGGGGGTCCCTGTGGTTT 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008898_1176008920 29 Left 1176008898 20:62881236-62881258 CCCCCTCACCGGTCTCAGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008901_1176008920 26 Left 1176008901 20:62881239-62881261 CCTCACCGGTCTCAGTGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008900_1176008920 27 Left 1176008900 20:62881238-62881260 CCCTCACCGGTCTCAGTGGCCAG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008909_1176008920 1 Left 1176008909 20:62881264-62881286 CCTCGCCTGCCGGGGGTCCCTGT 0: 1
1: 0
2: 2
3: 10
4: 185
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008907_1176008920 8 Left 1176008907 20:62881257-62881279 CCAGGCGCCTCGCCTGCCGGGGG 0: 1
1: 0
2: 2
3: 21
4: 247
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86
1176008912_1176008920 -8 Left 1176008912 20:62881273-62881295 CCGGGGGTCCCTGTGGTTTGACG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1176008920 20:62881288-62881310 GTTTGACGCCTGGCTGGCGGGGG 0: 1
1: 0
2: 1
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176008920 Original CRISPR GTTTGACGCCTGGCTGGCGG GGG Exonic