ID: 1176013626

View in Genome Browser
Species Human (GRCh38)
Location 20:62915170-62915192
Sequence GTCACTGTCCCTTTAAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176013626_1176013631 20 Left 1176013626 20:62915170-62915192 CCTCCTTTTAAAGGGACAGTGAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1176013631 20:62915213-62915235 ATCTGTGATCCCAGCTGCTTGGG No data
1176013626_1176013632 23 Left 1176013626 20:62915170-62915192 CCTCCTTTTAAAGGGACAGTGAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1176013632 20:62915216-62915238 TGTGATCCCAGCTGCTTGGGAGG 0: 46
1: 3127
2: 62921
3: 175675
4: 578472
1176013626_1176013630 19 Left 1176013626 20:62915170-62915192 CCTCCTTTTAAAGGGACAGTGAC 0: 1
1: 0
2: 1
3: 10
4: 167
Right 1176013630 20:62915212-62915234 CATCTGTGATCCCAGCTGCTTGG 0: 2
1: 172
2: 4365
3: 41168
4: 107134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176013626 Original CRISPR GTCACTGTCCCTTTAAAAGG AGG (reversed) Intronic
904304429 1:29578393-29578415 GTCACTTTCCCTGTTAAACGAGG - Intergenic
905570763 1:39002855-39002877 CTCAGTTTCCCCTTAAAAGGTGG + Intronic
909497851 1:76299439-76299461 GTCACTGCAACTTTAAAAAGGGG + Intronic
911075933 1:93874920-93874942 GTGACAGTCGCTTGAAAAGGAGG + Intronic
913208169 1:116560799-116560821 GAGACTGTCCCTAGAAAAGGAGG - Intronic
915733431 1:158069890-158069912 GTCATTGGCCCTTTATAAGCAGG + Intronic
915739542 1:158108145-158108167 GGGGCTGTCCTTTTAAAAGGAGG - Intergenic
916808407 1:168282689-168282711 GTCTCTGACCCTTTAAAAATGGG + Intronic
917083924 1:171286301-171286323 CTCATTGACTCTTTAAAAGGAGG - Intergenic
917514352 1:175695029-175695051 GACACTCCCCCTTCAAAAGGTGG + Intronic
917612342 1:176701389-176701411 GACAGTTTCCCTTTACAAGGCGG - Intronic
917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG + Intronic
919843339 1:201625098-201625120 GTCGATGTCCTTTTAAAACGTGG - Intronic
920551941 1:206869409-206869431 GTCACAGTCCTTTTGAGAGGAGG - Intergenic
1063073571 10:2691419-2691441 GTCACTGTCCTTTTACGTGGGGG - Intergenic
1064918464 10:20488603-20488625 GTCAATGTCTCGTTAGAAGGTGG - Intergenic
1065260705 10:23920653-23920675 GTCACTGACTGTTCAAAAGGAGG - Intronic
1066980429 10:42408698-42408720 GACACTGTCACTTTAAAAAATGG - Intergenic
1072953932 10:99872480-99872502 GACACTGGCCCTTTAAAGGAAGG - Intergenic
1074143986 10:110700632-110700654 GTCACTGTCCTGTGAAGAGGAGG - Intronic
1074248780 10:111722705-111722727 TACACTGTCAATTTAAAAGGAGG - Intergenic
1075293580 10:121252552-121252574 GTCACTGTCCCGTTAAACACAGG + Intergenic
1075384322 10:122044093-122044115 CTCACTCTTCCTTTAAAAGATGG - Intronic
1077094981 11:795450-795472 GTGCCTGGCCCTTTAAAAGCCGG - Intronic
1077332317 11:1989053-1989075 GTGACTGTCCCTTTCCAAAGAGG - Intergenic
1078701017 11:13682916-13682938 ATAAATGTCCCTTTAAAAGGGGG - Intronic
1078872338 11:15360138-15360160 TTCAATGTCCGTTTAAATGGTGG + Intergenic
1080300169 11:30775357-30775379 GTCACTCTAACTTCAAAAGGAGG + Intergenic
1080340741 11:31260702-31260724 GTCACTCTCCCTCTCAAGGGAGG - Intronic
1080779141 11:35414922-35414944 TTCAGTTTGCCTTTAAAAGGGGG + Intronic
1082217939 11:49597203-49597225 GTCTCTGTCTCTTGAGAAGGTGG + Intergenic
1083011402 11:59403665-59403687 ATGACTGTTTCTTTAAAAGGAGG + Intergenic
1083266260 11:61548281-61548303 GTCCCTGTCCCTTTCCAAGGTGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1086807430 11:91261951-91261973 TTAATTGTCCCTTTAAAAGGAGG - Intergenic
1088087358 11:105997110-105997132 GACCCTGTCCCTTTAAAAAAAGG + Intronic
1202815298 11_KI270721v1_random:44229-44251 GTGACTGTCCCTTTCCAAAGAGG - Intergenic
1092193542 12:6536010-6536032 GTCTCTGTCCCTTTTGTAGGAGG + Intronic
1092576975 12:9795732-9795754 GTCACGGTACCTTTCAAAGCAGG - Intergenic
1094039717 12:26110257-26110279 ATGTCTGTCCCTTTTAAAGGAGG + Intergenic
1094231506 12:28109361-28109383 GTCCCTCTCCCTTTCTAAGGTGG + Intergenic
1095619668 12:44236661-44236683 ATCACTGGCCCTATAATAGGCGG + Intronic
1097932832 12:65208745-65208767 GTCTCTGTTCATTTAATAGGTGG + Intronic
1101033218 12:100679988-100680010 GTCAGTGTCCCGTTGAAATGGGG - Intergenic
1101042474 12:100770838-100770860 GTCCCTGCCCCTTTATAAGAAGG - Intronic
1102834048 12:116036866-116036888 GCCACTGTCTTTTGAAAAGGAGG - Intronic
1103139475 12:118536078-118536100 CTCACTCTCCCTGTAAAATGGGG - Intergenic
1105488840 13:20866655-20866677 GACACTGACTATTTAAAAGGTGG - Intronic
1106511018 13:30412684-30412706 GTCAAAGTCTCTGTAAAAGGTGG + Intergenic
1111976891 13:94975632-94975654 GTCACTGCCCACTTAAAAGCAGG - Intergenic
1112564889 13:100544775-100544797 GTCACTGAACATTTTAAAGGTGG - Intronic
1112699724 13:101992347-101992369 GTCAATGGCCCTTTAATATGAGG - Intronic
1112807348 13:103177396-103177418 GTCACATTACCTTTAACAGGAGG + Intergenic
1116556520 14:46316881-46316903 GTCACTTTCCATTTTAAACGAGG - Intergenic
1116902105 14:50371564-50371586 ATCACTGTCTCTAAAAAAGGGGG - Intronic
1118888717 14:69888920-69888942 GTCACTGGCACTTTGGAAGGAGG - Intronic
1121945690 14:98119573-98119595 TTCACTGTCCCTCCCAAAGGAGG + Intergenic
1123945279 15:25235926-25235948 GACACTGTCCCATGAAAAGTGGG - Intergenic
1129666580 15:77582696-77582718 GTCACTGCCCCTTTTATGGGCGG - Intergenic
1129952567 15:79605009-79605031 GTCACTGGCCCTTTGAGAGAGGG + Intergenic
1133747796 16:8700604-8700626 GTCAATGTCTCTTTAAAAAAGGG - Intronic
1135153271 16:20029524-20029546 GTCAATGTCCATTCATAAGGGGG + Intergenic
1135381591 16:22000522-22000544 GTAGCTGTACTTTTAAAAGGGGG + Intronic
1136021445 16:27442973-27442995 GTCACAGTCACGTTGAAAGGGGG - Exonic
1136144298 16:28306905-28306927 GTCTCTGTGCCTGTAAAATGGGG - Intronic
1137641809 16:50038759-50038781 TTCTCTGTCCCTTTAAAATATGG - Intergenic
1138125657 16:54436387-54436409 GTCACTGTGCCTTTGGAAGGAGG - Intergenic
1145804632 17:27717742-27717764 GTTACTGTGGCTTTAAAAGCTGG - Intergenic
1146987247 17:37231974-37231996 TACAATGTCCCTTTAAATGGAGG + Intronic
1147241527 17:39093865-39093887 GTCACTGTGGCTCTAAGAGGAGG + Intronic
1148115528 17:45172621-45172643 GGCACTGGCCCTTTAAGTGGGGG + Intergenic
1150366690 17:64593939-64593961 GACACTATCCCTTGAAAAGTAGG - Intronic
1151281249 17:73075900-73075922 CTCACTGTCCCTGTAAAGTGGGG + Intronic
1151804180 17:76395579-76395601 GTGACCGCCCCTGTAAAAGGTGG + Intronic
1153274113 18:3351241-3351263 GTTAATTTCCTTTTAAAAGGAGG - Intergenic
1157201730 18:45665136-45665158 GTCCCTGTCCCTTCAGAAGTGGG + Intronic
1157807673 18:50670228-50670250 CTTACTGCCCCTTTGAAAGGCGG - Intronic
1159190423 18:65034781-65034803 ATCACTGCCACTCTAAAAGGGGG - Intergenic
1159599346 18:70413831-70413853 GTGGCTGTCCATTCAAAAGGTGG - Intergenic
1160912124 19:1479302-1479324 GGCACTATCCCTTTAAGACGGGG - Intronic
1161508960 19:4659974-4659996 ATCACTTTCCCTTTCAAATGCGG + Exonic
1161577595 19:5063448-5063470 GGCACTGTCCCTTTAGATGAAGG + Intronic
1161927070 19:7308942-7308964 GCGGCTGTCCCTTTAAAAGCTGG - Intergenic
1162340021 19:10086585-10086607 GTCACTTTCCTTTTCAAGGGGGG - Intronic
1165747889 19:38241198-38241220 CTCACTCTCCCATCAAAAGGTGG - Intergenic
1166881845 19:45934764-45934786 GGCTTTGTCCCTTTAAAAGGCGG - Exonic
925597622 2:5571438-5571460 GTCAATGTCACTTTATATGGTGG + Intergenic
927803299 2:26121301-26121323 GTCAATGACAGTTTAAAAGGGGG - Intronic
928377482 2:30787447-30787469 GTCTCAGTCCCTGTAAAGGGTGG - Intronic
929879970 2:45826995-45827017 GTGACTCACACTTTAAAAGGTGG - Intronic
932989791 2:76772600-76772622 GTTAATGCCCCTTTAAATGGAGG - Intronic
933386144 2:81612925-81612947 ATCACTGTCCCTTTCAAACCTGG - Intergenic
933617576 2:84498594-84498616 CTCACTGTCACTTTAGAAGCAGG - Intergenic
937036521 2:118786813-118786835 GCCACCGACCCTTTTAAAGGAGG + Intergenic
938483729 2:131682413-131682435 GCCGCGGTCCCTTTAAGAGGGGG + Intergenic
938752000 2:134341325-134341347 TACACTGTGCTTTTAAAAGGTGG + Intronic
938774676 2:134531088-134531110 TTCAGTGGCCTTTTAAAAGGGGG - Intronic
939401922 2:141705465-141705487 GTCACTCTACCTTTAAATGTAGG + Intronic
940139954 2:150483076-150483098 GTTACTGTGCCTTAAAAAGCAGG + Intronic
945407158 2:209462352-209462374 GTCACTGTCCTTTTTACACGTGG - Intronic
1174716981 20:52769627-52769649 CTCACTTTACATTTAAAAGGGGG - Intergenic
1176013626 20:62915170-62915192 GTCACTGTCCCTTTAAAAGGAGG - Intronic
1176152002 20:63596195-63596217 GTCTCTGTGCCTTTAGAAGGAGG - Intronic
1176152947 20:63602331-63602353 GTGACTGTCCCTTCCAAAGCTGG - Intronic
1177218925 21:18165611-18165633 GACACAGTCCCTCAAAAAGGAGG + Intronic
1177218938 21:18165764-18165786 GTCATTCTCTCATTAAAAGGTGG - Intronic
1178821805 21:35982244-35982266 GTCACTGAGCCTTTCAAAGAGGG + Intronic
1179058400 21:37956806-37956828 GTTAATGTCCCTTTCAAAGGTGG + Intronic
1179646583 21:42779630-42779652 GAGACAGTGCCTTTAAAAGGTGG + Intergenic
1181039528 22:20185200-20185222 GACCCTGTCTTTTTAAAAGGTGG - Intergenic
1183221872 22:36519755-36519777 GTCACCCTACCTTTAAAATGGGG - Intronic
1183849866 22:40576507-40576529 TGCATTATCCCTTTAAAAGGTGG - Intronic
1184609528 22:45593918-45593940 GACACTGTCCCTGAACAAGGAGG + Intronic
950942306 3:16905111-16905133 GTGACAGTCCCATTAAAATGTGG + Intronic
952520800 3:34155273-34155295 GACACTGTCCCATCAAGAGGTGG + Intergenic
952660611 3:35842073-35842095 GTTACTGTCCCTTTTATATGTGG - Intergenic
957709738 3:83840191-83840213 GTCACTTTCTCTTAAAAAGAGGG - Intergenic
958533661 3:95367231-95367253 GGCATAGTCACTTTAAAAGGTGG - Intergenic
960588172 3:119340602-119340624 GTCATTCTCCTTTTAAGAGGAGG - Intronic
962087665 3:132208928-132208950 GTTACTGTACCTTTAAAACAGGG - Intronic
966635678 3:182130526-182130548 GTTACTTTGCCTTTAAAATGGGG + Intergenic
967081830 3:186056905-186056927 GAAACTGTCCCATTAATAGGAGG + Intronic
970200406 4:13599260-13599282 GCCACGGTCCCTTGAACAGGTGG + Exonic
970828666 4:20308583-20308605 GTCACTGCCTCTGTAAAATGGGG + Intronic
971488705 4:27188886-27188908 GTGACTTTACCTTTAGAAGGGGG - Intergenic
973907813 4:55547912-55547934 GTGACTGTTACTTTAAAGGGAGG - Intergenic
974074157 4:57153720-57153742 AACACAGTCCCTTTAAAAGAAGG + Intergenic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
979679506 4:123444306-123444328 GTCACTGTCCCCTTTAAAGGGGG + Intergenic
980775021 4:137426134-137426156 GTAAATGTCCCTTTAAATGAAGG + Intergenic
985114564 4:186577974-186577996 GTCACTGTGCCGTTAAAGTGTGG - Intergenic
986049218 5:4071543-4071565 TTCTTTGTCCTTTTAAAAGGAGG - Intergenic
986718386 5:10540344-10540366 GTCTCTGTCCCTTGATAAGGGGG + Intergenic
987910519 5:24138120-24138142 TTCACTGTGCCCTTCAAAGGAGG - Intronic
988613127 5:32746845-32746867 CTGACTGTCCCTTTAACAGTTGG + Intronic
990490416 5:56297850-56297872 TACAGTTTCCCTTTAAAAGGTGG + Intergenic
990713448 5:58609408-58609430 GGTTCTGTTCCTTTAAAAGGGGG + Intronic
993692200 5:91015827-91015849 GCCACTGTGCCTTTTAAATGGGG + Intronic
993899479 5:93574639-93574661 GCCACTTTCCCCTTAAAAGTGGG + Intergenic
994565302 5:101438425-101438447 GTCATTCTGCCTTTAAAAAGAGG - Intergenic
998767870 5:145508498-145508520 GTCACCATCCCATTAAATGGGGG - Intronic
998853727 5:146375169-146375191 GGAACTGTCCCTTTGAAAGATGG + Intergenic
1005883799 6:30079603-30079625 GTCACTGCACCTTTAAAATTTGG - Intergenic
1007030561 6:38622440-38622462 GTTACTGTGGCTTTAAAAGCTGG - Intronic
1007532300 6:42553956-42553978 GCCAATGTCCCTGTAAAAGTGGG + Intergenic
1010367644 6:75070557-75070579 GACAATGCCCCTTTAAATGGAGG - Intergenic
1010783935 6:79978084-79978106 GACACTGCCTCTATAAAAGGGGG - Intergenic
1011693367 6:89889756-89889778 GCCACTATCTCTTTAAAATGTGG - Intergenic
1012646975 6:101697205-101697227 GTCACAGGGCCTTTAAGAGGAGG - Intronic
1015210023 6:130686474-130686496 GTCATTCTCCCATTAAAAGAAGG + Intergenic
1016286382 6:142478006-142478028 GTCTCTGCCCATTTGAAAGGAGG - Intergenic
1020422131 7:8019552-8019574 GTCACTGTCACTTCATGAGGGGG + Intronic
1021222451 7:17989718-17989740 GGCAATGTGCCTTTAAAAGCAGG - Intergenic
1022341641 7:29473816-29473838 GTCTCTTCCCCTGTAAAAGGTGG + Intronic
1022674800 7:32489230-32489252 GTCAGTATCCTTTTAAAAGGTGG - Exonic
1024559559 7:50631805-50631827 GTCTCTGCCCCTTTGACAGGAGG + Intronic
1026476452 7:70740038-70740060 TGCACAGCCCCTTTAAAAGGAGG + Intronic
1028191783 7:87862197-87862219 GACACTGTCCCTTTTTAGGGAGG + Intronic
1033611801 7:142970433-142970455 CTCACTATGCCTTTCAAAGGTGG - Intergenic
1038153065 8:24959443-24959465 GTCGCAGTCTCTTTAGAAGGAGG + Intergenic
1041588562 8:59548824-59548846 ATCACTTTGCATTTAAAAGGTGG + Intergenic
1042596682 8:70456174-70456196 GTCTCTGCACCTATAAAAGGAGG + Intergenic
1042981609 8:74535580-74535602 TTCACTCTCCCTTCAAAATGAGG + Intergenic
1048314382 8:133351322-133351344 GTAACTGTCCTTTTAAGAAGAGG - Intergenic
1048502620 8:134992560-134992582 GTCACTGCCACATTGAAAGGAGG - Intergenic
1050727316 9:8665747-8665769 GTCACAGTCCCTTTGCAAGAAGG + Intronic
1052758075 9:32561973-32561995 GTCACTCTCCCATTAAAAAATGG + Intronic
1054317666 9:63613020-63613042 GTCACTGGCCCTTTCAAACTAGG - Intergenic
1059433183 9:114261856-114261878 GTTTCTGTCCCTGTGAAAGGAGG + Intronic
1061429970 9:130524604-130524626 GTACCTGTCCCTGTAAAATGGGG - Intergenic
1061950471 9:133933123-133933145 GTTAGTGTCCCTTTAACACGTGG + Intronic
1062366780 9:136213661-136213683 GACACTCTCCCATTAACAGGTGG + Intronic
1187313938 X:18174356-18174378 GCAACTGACTCTTTAAAAGGTGG + Intronic
1187527454 X:20066895-20066917 GCCACTGTCCCCTTACATGGTGG + Intronic
1187560309 X:20396589-20396611 GTCACTCTCCCCTCAAAAGGTGG - Intergenic
1189562827 X:42208593-42208615 GAAACTGTCCCTTTAAAATAAGG + Intergenic
1190619374 X:52269896-52269918 GTCATTGTTCTTTTAAGAGGTGG + Intergenic
1195366335 X:104130191-104130213 GTCACTGTCCCTGTTATAGCAGG - Intronic
1198026063 X:132708491-132708513 TTTACTGTTCCTTTAACAGGTGG - Exonic