ID: 1176013741

View in Genome Browser
Species Human (GRCh38)
Location 20:62916679-62916701
Sequence ACTCTATGGGAACAGATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176013741_1176013745 23 Left 1176013741 20:62916679-62916701 CCCTCAATCTGTTCCCATAGAGT No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176013741 Original CRISPR ACTCTATGGGAACAGATTGA GGG (reversed) Intronic