ID: 1176013742

View in Genome Browser
Species Human (GRCh38)
Location 20:62916680-62916702
Sequence CACTCTATGGGAACAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176013742_1176013745 22 Left 1176013742 20:62916680-62916702 CCTCAATCTGTTCCCATAGAGTG No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176013742 Original CRISPR CACTCTATGGGAACAGATTG AGG (reversed) Intronic