ID: 1176013744

View in Genome Browser
Species Human (GRCh38)
Location 20:62916693-62916715
Sequence GTTTTAGCTGAAACACTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176013744_1176013745 9 Left 1176013744 20:62916693-62916715 CCATAGAGTGTTTCAGCTAAAAC No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data
1176013744_1176013747 21 Left 1176013744 20:62916693-62916715 CCATAGAGTGTTTCAGCTAAAAC No data
Right 1176013747 20:62916737-62916759 ACACAGATAGGTCTTTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176013744 Original CRISPR GTTTTAGCTGAAACACTCTA TGG (reversed) Intronic