ID: 1176013745

View in Genome Browser
Species Human (GRCh38)
Location 20:62916725-62916747
Sequence AAATCTTGCCTCACACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176013744_1176013745 9 Left 1176013744 20:62916693-62916715 CCATAGAGTGTTTCAGCTAAAAC No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data
1176013741_1176013745 23 Left 1176013741 20:62916679-62916701 CCCTCAATCTGTTCCCATAGAGT No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data
1176013742_1176013745 22 Left 1176013742 20:62916680-62916702 CCTCAATCTGTTCCCATAGAGTG No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data
1176013743_1176013745 10 Left 1176013743 20:62916692-62916714 CCCATAGAGTGTTTCAGCTAAAA No data
Right 1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176013745 Original CRISPR AAATCTTGCCTCACACAGAT AGG Intronic