ID: 1176014928

View in Genome Browser
Species Human (GRCh38)
Location 20:62926195-62926217
Sequence CGGGCCTCAGACGCCGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176014928_1176014931 -8 Left 1176014928 20:62926195-62926217 CCAGGGCCGGCGTCTGAGGCCCG No data
Right 1176014931 20:62926210-62926232 GAGGCCCGCGCCCCAGGCCGCGG No data
1176014928_1176014938 5 Left 1176014928 20:62926195-62926217 CCAGGGCCGGCGTCTGAGGCCCG No data
Right 1176014938 20:62926223-62926245 CAGGCCGCGGCGGCTCTGACCGG No data
1176014928_1176014932 -5 Left 1176014928 20:62926195-62926217 CCAGGGCCGGCGTCTGAGGCCCG No data
Right 1176014932 20:62926213-62926235 GCCCGCGCCCCAGGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176014928 Original CRISPR CGGGCCTCAGACGCCGGCCC TGG (reversed) Intronic