ID: 1176015504

View in Genome Browser
Species Human (GRCh38)
Location 20:62929259-62929281
Sequence CTCGGCGGGGGCCCTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015504_1176015513 -3 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015513 20:62929279-62929301 GAGGCCACCGGGCAGCGTCCAGG 0: 1
1: 0
2: 2
3: 19
4: 186
1176015504_1176015522 16 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015522 20:62929298-62929320 CAGGTCTCGGCCTTTGGGAGGGG No data
1176015504_1176015521 15 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015521 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
1176015504_1176015523 24 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015523 20:62929306-62929328 GGCCTTTGGGAGGGGAGCAGCGG No data
1176015504_1176015519 14 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015519 20:62929296-62929318 TCCAGGTCTCGGCCTTTGGGAGG No data
1176015504_1176015524 25 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015524 20:62929307-62929329 GCCTTTGGGAGGGGAGCAGCGGG No data
1176015504_1176015515 3 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015515 20:62929285-62929307 ACCGGGCAGCGTCCAGGTCTCGG 0: 1
1: 0
2: 0
3: 6
4: 75
1176015504_1176015526 26 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015504_1176015528 30 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG No data
1176015504_1176015518 11 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015518 20:62929293-62929315 GCGTCCAGGTCTCGGCCTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1176015504_1176015517 10 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015517 20:62929292-62929314 AGCGTCCAGGTCTCGGCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1176015504_1176015527 27 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015527 20:62929309-62929331 CTTTGGGAGGGGAGCAGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015504 Original CRISPR CTCGGCGGGGGCCCTGTCCT TGG (reversed) Intronic