ID: 1176015512

View in Genome Browser
Species Human (GRCh38)
Location 20:62929277-62929299
Sequence TGGACGCTGCCCGGTGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015512_1176015529 13 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015529 20:62929313-62929335 GGGAGGGGAGCAGCGGGGGAGGG No data
1176015512_1176015526 8 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015512_1176015536 26 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015512_1176015519 -4 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015519 20:62929296-62929318 TCCAGGTCTCGGCCTTTGGGAGG No data
1176015512_1176015522 -2 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015522 20:62929298-62929320 CAGGTCTCGGCCTTTGGGAGGGG No data
1176015512_1176015535 25 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015535 20:62929325-62929347 GCGGGGGAGGGGCACGGGGAGGG No data
1176015512_1176015527 9 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015527 20:62929309-62929331 CTTTGGGAGGGGAGCAGCGGGGG No data
1176015512_1176015532 20 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015532 20:62929320-62929342 GAGCAGCGGGGGAGGGGCACGGG No data
1176015512_1176015528 12 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG No data
1176015512_1176015523 6 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015523 20:62929306-62929328 GGCCTTTGGGAGGGGAGCAGCGG No data
1176015512_1176015518 -7 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015518 20:62929293-62929315 GCGTCCAGGTCTCGGCCTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 57
1176015512_1176015531 19 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015531 20:62929319-62929341 GGAGCAGCGGGGGAGGGGCACGG No data
1176015512_1176015534 24 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015534 20:62929324-62929346 AGCGGGGGAGGGGCACGGGGAGG No data
1176015512_1176015517 -8 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015517 20:62929292-62929314 AGCGTCCAGGTCTCGGCCTTTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1176015512_1176015533 21 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015533 20:62929321-62929343 AGCAGCGGGGGAGGGGCACGGGG No data
1176015512_1176015530 14 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015530 20:62929314-62929336 GGAGGGGAGCAGCGGGGGAGGGG No data
1176015512_1176015521 -3 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015521 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
1176015512_1176015524 7 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015524 20:62929307-62929329 GCCTTTGGGAGGGGAGCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015512 Original CRISPR TGGACGCTGCCCGGTGGCCT CGG (reversed) Intronic