ID: 1176015513 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:62929279-62929301 |
| Sequence | GAGGCCACCGGGCAGCGTCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 208 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 19, 4: 186} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176015499_1176015513 | 20 | Left | 1176015499 | 20:62929236-62929258 | CCTGGGATTCAGAGAGGCAGCGG | 0: 1 1: 0 2: 1 3: 25 4: 246 |
||
| Right | 1176015513 | 20:62929279-62929301 | GAGGCCACCGGGCAGCGTCCAGG | 0: 1 1: 0 2: 2 3: 19 4: 186 |
||||
| 1176015504_1176015513 | -3 | Left | 1176015504 | 20:62929259-62929281 | CCAAGGACAGGGCCCCCGCCGAG | 0: 1 1: 0 2: 1 3: 13 4: 173 |
||
| Right | 1176015513 | 20:62929279-62929301 | GAGGCCACCGGGCAGCGTCCAGG | 0: 1 1: 0 2: 2 3: 19 4: 186 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176015513 | Original CRISPR | GAGGCCACCGGGCAGCGTCC AGG | Intronic | ||