ID: 1176015514

View in Genome Browser
Species Human (GRCh38)
Location 20:62929283-62929305
Sequence GAGACCTGGACGCTGCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015514_1176015534 18 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015534 20:62929324-62929346 AGCGGGGGAGGGGCACGGGGAGG No data
1176015514_1176015522 -8 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015522 20:62929298-62929320 CAGGTCTCGGCCTTTGGGAGGGG No data
1176015514_1176015528 6 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG No data
1176015514_1176015533 15 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015533 20:62929321-62929343 AGCAGCGGGGGAGGGGCACGGGG No data
1176015514_1176015537 25 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015537 20:62929331-62929353 GAGGGGCACGGGGAGGGGCGAGG No data
1176015514_1176015536 20 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015514_1176015540 30 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015540 20:62929336-62929358 GCACGGGGAGGGGCGAGGGCGGG No data
1176015514_1176015539 29 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data
1176015514_1176015524 1 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015524 20:62929307-62929329 GCCTTTGGGAGGGGAGCAGCGGG No data
1176015514_1176015535 19 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015535 20:62929325-62929347 GCGGGGGAGGGGCACGGGGAGGG No data
1176015514_1176015521 -9 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015521 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
1176015514_1176015538 26 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015538 20:62929332-62929354 AGGGGCACGGGGAGGGGCGAGGG No data
1176015514_1176015527 3 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015527 20:62929309-62929331 CTTTGGGAGGGGAGCAGCGGGGG No data
1176015514_1176015519 -10 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015519 20:62929296-62929318 TCCAGGTCTCGGCCTTTGGGAGG No data
1176015514_1176015529 7 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015529 20:62929313-62929335 GGGAGGGGAGCAGCGGGGGAGGG No data
1176015514_1176015526 2 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015514_1176015531 13 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015531 20:62929319-62929341 GGAGCAGCGGGGGAGGGGCACGG No data
1176015514_1176015532 14 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015532 20:62929320-62929342 GAGCAGCGGGGGAGGGGCACGGG No data
1176015514_1176015530 8 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015530 20:62929314-62929336 GGAGGGGAGCAGCGGGGGAGGGG No data
1176015514_1176015523 0 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015523 20:62929306-62929328 GGCCTTTGGGAGGGGAGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015514 Original CRISPR GAGACCTGGACGCTGCCCGG TGG (reversed) Intronic