ID: 1176015516

View in Genome Browser
Species Human (GRCh38)
Location 20:62929286-62929308
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015516_1176015532 11 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015532 20:62929320-62929342 GAGCAGCGGGGGAGGGGCACGGG No data
1176015516_1176015530 5 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015530 20:62929314-62929336 GGAGGGGAGCAGCGGGGGAGGGG No data
1176015516_1176015529 4 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015529 20:62929313-62929335 GGGAGGGGAGCAGCGGGGGAGGG No data
1176015516_1176015533 12 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015533 20:62929321-62929343 AGCAGCGGGGGAGGGGCACGGGG No data
1176015516_1176015541 28 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015541 20:62929337-62929359 CACGGGGAGGGGCGAGGGCGGGG No data
1176015516_1176015538 23 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015538 20:62929332-62929354 AGGGGCACGGGGAGGGGCGAGGG No data
1176015516_1176015531 10 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015531 20:62929319-62929341 GGAGCAGCGGGGGAGGGGCACGG No data
1176015516_1176015527 0 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015527 20:62929309-62929331 CTTTGGGAGGGGAGCAGCGGGGG No data
1176015516_1176015524 -2 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015524 20:62929307-62929329 GCCTTTGGGAGGGGAGCAGCGGG No data
1176015516_1176015539 26 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data
1176015516_1176015535 16 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015535 20:62929325-62929347 GCGGGGGAGGGGCACGGGGAGGG No data
1176015516_1176015536 17 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015516_1176015526 -1 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015516_1176015523 -3 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015523 20:62929306-62929328 GGCCTTTGGGAGGGGAGCAGCGG No data
1176015516_1176015528 3 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG No data
1176015516_1176015534 15 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015534 20:62929324-62929346 AGCGGGGGAGGGGCACGGGGAGG No data
1176015516_1176015537 22 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015537 20:62929331-62929353 GAGGGGCACGGGGAGGGGCGAGG No data
1176015516_1176015540 27 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015540 20:62929336-62929358 GCACGGGGAGGGGCGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015516 Original CRISPR GCCGAGACCTGGACGCTGCC CGG (reversed) Intronic