ID: 1176015520

View in Genome Browser
Species Human (GRCh38)
Location 20:62929297-62929319
Sequence CCCTCCCAAAGGCCGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015520_1176015540 16 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015540 20:62929336-62929358 GCACGGGGAGGGGCGAGGGCGGG No data
1176015520_1176015536 6 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015520_1176015541 17 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015541 20:62929337-62929359 CACGGGGAGGGGCGAGGGCGGGG No data
1176015520_1176015542 26 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG No data
1176015520_1176015532 0 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015532 20:62929320-62929342 GAGCAGCGGGGGAGGGGCACGGG No data
1176015520_1176015530 -6 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015530 20:62929314-62929336 GGAGGGGAGCAGCGGGGGAGGGG No data
1176015520_1176015537 11 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015537 20:62929331-62929353 GAGGGGCACGGGGAGGGGCGAGG No data
1176015520_1176015528 -8 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015528 20:62929312-62929334 TGGGAGGGGAGCAGCGGGGGAGG No data
1176015520_1176015534 4 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015534 20:62929324-62929346 AGCGGGGGAGGGGCACGGGGAGG No data
1176015520_1176015538 12 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015538 20:62929332-62929354 AGGGGCACGGGGAGGGGCGAGGG No data
1176015520_1176015543 27 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015543 20:62929347-62929369 GGCGAGGGCGGGGCGCGCCTGGG No data
1176015520_1176015529 -7 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015529 20:62929313-62929335 GGGAGGGGAGCAGCGGGGGAGGG No data
1176015520_1176015535 5 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015535 20:62929325-62929347 GCGGGGGAGGGGCACGGGGAGGG No data
1176015520_1176015533 1 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015533 20:62929321-62929343 AGCAGCGGGGGAGGGGCACGGGG No data
1176015520_1176015531 -1 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015531 20:62929319-62929341 GGAGCAGCGGGGGAGGGGCACGG No data
1176015520_1176015539 15 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015520 Original CRISPR CCCTCCCAAAGGCCGAGACC TGG (reversed) Intronic