ID: 1176015525

View in Genome Browser
Species Human (GRCh38)
Location 20:62929308-62929330
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015525_1176015535 -6 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015535 20:62929325-62929347 GCGGGGGAGGGGCACGGGGAGGG No data
1176015525_1176015537 0 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015537 20:62929331-62929353 GAGGGGCACGGGGAGGGGCGAGG No data
1176015525_1176015544 22 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015544 20:62929353-62929375 GGCGGGGCGCGCCTGGGCCTCGG No data
1176015525_1176015533 -10 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015533 20:62929321-62929343 AGCAGCGGGGGAGGGGCACGGGG No data
1176015525_1176015545 28 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG No data
1176015525_1176015539 4 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data
1176015525_1176015542 15 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG No data
1176015525_1176015540 5 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015540 20:62929336-62929358 GCACGGGGAGGGGCGAGGGCGGG No data
1176015525_1176015538 1 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015538 20:62929332-62929354 AGGGGCACGGGGAGGGGCGAGGG No data
1176015525_1176015541 6 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015541 20:62929337-62929359 CACGGGGAGGGGCGAGGGCGGGG No data
1176015525_1176015536 -5 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015525_1176015546 29 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015546 20:62929360-62929382 CGCGCCTGGGCCTCGGCGCTGGG No data
1176015525_1176015543 16 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015543 20:62929347-62929369 GGCGAGGGCGGGGCGCGCCTGGG No data
1176015525_1176015534 -7 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015534 20:62929324-62929346 AGCGGGGGAGGGGCACGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015525 Original CRISPR CCCCGCTGCTCCCCTCCCAA AGG (reversed) Intronic