ID: 1176015526

View in Genome Browser
Species Human (GRCh38)
Location 20:62929308-62929330
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015508_1176015526 14 Left 1176015508 20:62929271-62929293 CCCCCGCCGAGGCCACCGGGCAG 0: 1
1: 0
2: 0
3: 22
4: 207
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015510_1176015526 12 Left 1176015510 20:62929273-62929295 CCCGCCGAGGCCACCGGGCAGCG 0: 1
1: 0
2: 0
3: 22
4: 181
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015512_1176015526 8 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015509_1176015526 13 Left 1176015509 20:62929272-62929294 CCCCGCCGAGGCCACCGGGCAGC 0: 1
1: 0
2: 2
3: 27
4: 179
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015504_1176015526 26 Left 1176015504 20:62929259-62929281 CCAAGGACAGGGCCCCCGCCGAG 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015514_1176015526 2 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015516_1176015526 -1 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
1176015511_1176015526 11 Left 1176015511 20:62929274-62929296 CCGCCGAGGCCACCGGGCAGCGT 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1176015526 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type