ID: 1176015536

View in Genome Browser
Species Human (GRCh38)
Location 20:62929326-62929348
Sequence CGGGGGAGGGGCACGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015510_1176015536 30 Left 1176015510 20:62929273-62929295 CCCGCCGAGGCCACCGGGCAGCG 0: 1
1: 0
2: 0
3: 22
4: 181
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015516_1176015536 17 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015520_1176015536 6 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015512_1176015536 26 Left 1176015512 20:62929277-62929299 CCGAGGCCACCGGGCAGCGTCCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015514_1176015536 20 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015525_1176015536 -5 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data
1176015511_1176015536 29 Left 1176015511 20:62929274-62929296 CCGCCGAGGCCACCGGGCAGCGT 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1176015536 20:62929326-62929348 CGGGGGAGGGGCACGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015536 Original CRISPR CGGGGGAGGGGCACGGGGAG GGG Intronic