ID: 1176015539

View in Genome Browser
Species Human (GRCh38)
Location 20:62929335-62929357
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015516_1176015539 26 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data
1176015520_1176015539 15 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data
1176015514_1176015539 29 Left 1176015514 20:62929283-62929305 CCACCGGGCAGCGTCCAGGTCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data
1176015525_1176015539 4 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015539 20:62929335-62929357 GGCACGGGGAGGGGCGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type