ID: 1176015541

View in Genome Browser
Species Human (GRCh38)
Location 20:62929337-62929359
Sequence CACGGGGAGGGGCGAGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015520_1176015541 17 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015541 20:62929337-62929359 CACGGGGAGGGGCGAGGGCGGGG No data
1176015516_1176015541 28 Left 1176015516 20:62929286-62929308 CCGGGCAGCGTCCAGGTCTCGGC 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1176015541 20:62929337-62929359 CACGGGGAGGGGCGAGGGCGGGG No data
1176015525_1176015541 6 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015541 20:62929337-62929359 CACGGGGAGGGGCGAGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015541 Original CRISPR CACGGGGAGGGGCGAGGGCG GGG Intronic