ID: 1176015542

View in Genome Browser
Species Human (GRCh38)
Location 20:62929346-62929368
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015520_1176015542 26 Left 1176015520 20:62929297-62929319 CCAGGTCTCGGCCTTTGGGAGGG No data
Right 1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG No data
1176015525_1176015542 15 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type