ID: 1176015542 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:62929346-62929368 |
| Sequence | GGGCGAGGGCGGGGCGCGCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176015520_1176015542 | 26 | Left | 1176015520 | 20:62929297-62929319 | CCAGGTCTCGGCCTTTGGGAGGG | No data | ||
| Right | 1176015542 | 20:62929346-62929368 | GGGCGAGGGCGGGGCGCGCCTGG | No data | ||||
| 1176015525_1176015542 | 15 | Left | 1176015525 | 20:62929308-62929330 | CCTTTGGGAGGGGAGCAGCGGGG | No data | ||
| Right | 1176015542 | 20:62929346-62929368 | GGGCGAGGGCGGGGCGCGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176015542 | Original CRISPR | GGGCGAGGGCGGGGCGCGCC TGG | Intronic | ||