ID: 1176015546

View in Genome Browser
Species Human (GRCh38)
Location 20:62929360-62929382
Sequence CGCGCCTGGGCCTCGGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176015525_1176015546 29 Left 1176015525 20:62929308-62929330 CCTTTGGGAGGGGAGCAGCGGGG No data
Right 1176015546 20:62929360-62929382 CGCGCCTGGGCCTCGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176015546 Original CRISPR CGCGCCTGGGCCTCGGCGCT GGG Intronic