ID: 1176019842

View in Genome Browser
Species Human (GRCh38)
Location 20:62957002-62957024
Sequence CGCCCCACTGGGGCCTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176019826_1176019842 8 Left 1176019826 20:62956971-62956993 CCATCTTCCCCATCTCCTGGCTG 0: 1
1: 1
2: 9
3: 98
4: 819
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019823_1176019842 28 Left 1176019823 20:62956951-62956973 CCTCGGGGATCGGTAACTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019834_1176019842 -1 Left 1176019834 20:62956980-62957002 CCATCTCCTGGCTGGTGGGGGCC 0: 1
1: 0
2: 3
3: 27
4: 399
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019831_1176019842 1 Left 1176019831 20:62956978-62957000 CCCCATCTCCTGGCTGGTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019835_1176019842 -7 Left 1176019835 20:62956986-62957008 CCTGGCTGGTGGGGGCCGCCCCA 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019825_1176019842 9 Left 1176019825 20:62956970-62956992 CCCATCTTCCCCATCTCCTGGCT 0: 1
1: 0
2: 7
3: 75
4: 584
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019833_1176019842 0 Left 1176019833 20:62956979-62957001 CCCATCTCCTGGCTGGTGGGGGC 0: 1
1: 0
2: 3
3: 19
4: 273
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176019842 Original CRISPR CGCCCCACTGGGGCCTCCAG GGG Intronic
900132211 1:1091948-1091970 CGCCCCACCCGTGCCTCCAAAGG - Intronic
900339693 1:2182225-2182247 GGCCCCCCTGGGCCCTGCAGTGG + Intronic
900369818 1:2326692-2326714 GGACTTACTGGGGCCTCCAGAGG - Intronic
900395433 1:2451463-2451485 AGCCCTACTGGGGCTGCCAGGGG - Intronic
900537021 1:3183803-3183825 TGCCCCACTTCGGGCTCCAGCGG + Intronic
900545100 1:3224389-3224411 GGGCGCACCGGGGCCTCCAGAGG - Intronic
900739659 1:4322991-4323013 CGTCAGACTGGGCCCTCCAGGGG + Intergenic
902519040 1:17005445-17005467 CCCCCCACAGGGGCTTCCAACGG + Exonic
902748735 1:18491423-18491445 CACCCCACTGTGTCATCCAGGGG - Intergenic
903810001 1:26029847-26029869 CTCCCCTCTGGGGCTCCCAGAGG + Intronic
905302325 1:36993878-36993900 AGCCCCACTGGGGCTGACAGAGG + Intronic
907406055 1:54254150-54254172 CACACCCCTGGGGCCTACAGGGG + Intronic
908817769 1:68051590-68051612 CGCCCCATCGGGTCCGCCAGCGG + Exonic
913129628 1:115828190-115828212 CGCCCCACTGGGGCCTTCGGTGG + Intergenic
913962229 1:143349256-143349278 CCCCCCATTGGAGCCTTCAGAGG + Intergenic
914056585 1:144174830-144174852 CCCCCCATTGGAGCCTTCAGAGG + Intergenic
914122561 1:144791532-144791554 CCCCCCATTGGAGCCTTCAGAGG - Intergenic
920651487 1:207840554-207840576 GGCCCCACAGAGGCCACCAGGGG + Intergenic
922614083 1:226950963-226950985 TGACCCACTGGGACATCCAGAGG + Intronic
922721618 1:227902839-227902861 CGCCCCACTGGTGCCCACAGTGG - Intergenic
923123048 1:231012038-231012060 CTCCCCACTGGAGGCTCTAGGGG + Intergenic
923631216 1:235650218-235650240 CGCCCCACAGACCCCTCCAGTGG - Intronic
1065918068 10:30368617-30368639 GGCCCTGCTGGGGGCTCCAGGGG + Intronic
1066455693 10:35569485-35569507 CGCCCCCATGGGGACTCCAGAGG - Exonic
1067343837 10:45424157-45424179 AGCACCACTTGGGCCCCCAGAGG - Intronic
1067556777 10:47278309-47278331 CGCCTCTCTGGAGCCTACAGAGG - Intergenic
1069595247 10:69666036-69666058 TGCGACCCTGGGGCCTCCAGAGG + Intergenic
1069929814 10:71874801-71874823 CGCCCAACTGGGCCTTCCATGGG + Intergenic
1073042246 10:100615613-100615635 TGCCCCAGCGGGGCCTGCAGCGG - Intergenic
1073104890 10:101026923-101026945 GGCCTCACTGGGGCCTCCCTAGG + Intronic
1074528303 10:114279635-114279657 TGCCACTCTGGGGCCACCAGAGG + Intronic
1074534558 10:114319602-114319624 CACCCATCTGGGGACTCCAGTGG + Intronic
1075603698 10:123789271-123789293 CGCCCCACAGGGCCCCTCAGAGG + Intronic
1076705357 10:132298374-132298396 CGCCCCACTGGGCCCCACATTGG - Intronic
1077230336 11:1455753-1455775 CGCCTCACTGGGGCCGGCATGGG - Intronic
1077500076 11:2905375-2905397 CCCCACACTGCTGCCTCCAGTGG - Intronic
1077557201 11:3231431-3231453 TGCCCCACTGGGGGCTCGGGAGG + Intronic
1081673336 11:44954150-44954172 CACCCCCCTGGGGCCTTGAGAGG - Intergenic
1082788457 11:57330641-57330663 AGCCCCACTGGGGGCTCCTGAGG + Intronic
1082790014 11:57340634-57340656 CGCCCTCCTGGGGCTTACAGCGG + Intronic
1084155232 11:67309567-67309589 TGCCCCACTGTGGCTTCAAGCGG + Intronic
1084705634 11:70814636-70814658 AGCCCCACTGGGTCCTGCCGGGG + Intronic
1085098392 11:73779533-73779555 CGCCCCTCTGGGGCTGCGAGAGG - Intergenic
1085273218 11:75282567-75282589 CGCTCCCCGAGGGCCTCCAGAGG + Intronic
1085510001 11:77083358-77083380 AGCCTCACTGGGGCCTCATGTGG - Intronic
1088528790 11:110785931-110785953 TGCCCCAGTGGGGTCTCCATGGG - Intergenic
1089532414 11:119139140-119139162 AGCCTCACTGGAACCTCCAGTGG - Intergenic
1090554827 11:127862937-127862959 CACCACACTGGGGCCTGCTGGGG - Intergenic
1091122107 11:133065208-133065230 TGCTTCACTGGGGCCTCCGGGGG + Intronic
1095965104 12:47862324-47862346 CGACCCACTGGGGCCACGAGAGG + Intronic
1097269797 12:57766975-57766997 CGCCCAACTCGGGCGCCCAGCGG + Exonic
1103514697 12:121500053-121500075 GGCCCCCCTGCGGCCACCAGGGG + Intronic
1106674901 13:31948060-31948082 CTCTCCACTAGGGTCTCCAGTGG + Intergenic
1113659741 13:112097642-112097664 GACCCCACTGAGGCCTCAAGAGG + Intergenic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1120882948 14:89428798-89428820 CGCCCCACGAGTGCCTGCAGAGG + Intronic
1122143876 14:99677435-99677457 TGCTCCTCTCGGGCCTCCAGTGG + Exonic
1122394059 14:101410216-101410238 CAGCCCACTGTGGCCTCCAGAGG + Intergenic
1122906552 14:104804269-104804291 CGCGGCACTGGGTCCCCCAGTGG + Exonic
1122982209 14:105196923-105196945 CGCCCCGCTGGGGACTAAAGAGG + Intergenic
1124629321 15:31327854-31327876 CGCCCCATCGGGGACTCCGGGGG - Intronic
1127774494 15:62254538-62254560 CCCCCTGCTGGGGGCTCCAGGGG + Intergenic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1129109454 15:73329126-73329148 CGGGCCACTGGGGACTCCAGTGG + Intronic
1129267469 15:74401669-74401691 CCTCCCTCTGGGGCCTCCTGTGG + Intergenic
1130042005 15:80413159-80413181 CGGCCCACTGAGGCCATCAGAGG - Intronic
1131156959 15:90081340-90081362 CTCCCCACTGAGGCCTCAGGAGG - Exonic
1135178501 16:20252511-20252533 CTCACCCCTGGAGCCTCCAGAGG - Intergenic
1135585203 16:23665080-23665102 CTTCCCACTGGGGTTTCCAGAGG - Intronic
1139647973 16:68345872-68345894 CAACCCACTGGCACCTCCAGAGG - Intronic
1141592224 16:85076881-85076903 CACCCCACTGGGACCTGCAGAGG + Intronic
1141680064 16:85538640-85538662 CTCCCCACAGGGGCCTCCGAAGG - Intergenic
1141960621 16:87405161-87405183 CTCCCCACTGGGTCCCCCAAGGG - Intergenic
1142346176 16:89555449-89555471 TGCCCCATGGGGGCCTCCACGGG - Intronic
1143623385 17:8094011-8094033 CGCCCCCTTGTGGCCACCAGGGG - Intergenic
1144837353 17:18163661-18163683 GGCCCCACTCAGGCCCCCAGAGG - Intronic
1145260296 17:21350744-21350766 AGCGCCACTGAGGCATCCAGAGG + Intergenic
1145316322 17:21737196-21737218 AGCGCCACTGAGGCATCCAGAGG - Intergenic
1145734590 17:27218449-27218471 GGCCCAACTGGGGGCTCCATTGG + Intergenic
1146284996 17:31568411-31568433 CAGCCCACTGGGGTCTCCACCGG + Intergenic
1147557530 17:41488881-41488903 CACCCCACAGGGGCATCCCGAGG + Intronic
1147945960 17:44080344-44080366 AGCCCCTCTGGGCCCTGCAGTGG - Intronic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1148124947 17:45231668-45231690 CACCCCACTGCAGGCTCCAGCGG - Intronic
1148751375 17:49947516-49947538 GACCCCACTGGGGTCGCCAGGGG + Intergenic
1149286568 17:55171778-55171800 CCCGCCCCTGGGGCCTTCAGAGG + Intergenic
1151451266 17:74199791-74199813 CGCCCCCGTGCGGCCGCCAGTGG + Intergenic
1151757358 17:76082453-76082475 CTCCCCACAGAGCCCTCCAGAGG + Exonic
1152376196 17:79920089-79920111 CGCCCCACTCGGGGCTCCCCGGG - Intergenic
1152411256 17:80124475-80124497 GGCCCCACAGTGGCCGCCAGAGG - Intergenic
1152782288 17:82231708-82231730 AGCCCCACTTGGGGCACCAGTGG + Intronic
1152941288 17:83174006-83174028 CGCCTCGTCGGGGCCTCCAGGGG - Intergenic
1155003358 18:21706803-21706825 CGCCCCACTGTGGGCTCCTGCGG + Intronic
1156046309 18:32881365-32881387 GGCCCCACTGGGGCCACTAGTGG + Intergenic
1158703765 18:59772102-59772124 TGCCCCTCTGGGGCTTCCAGAGG + Intergenic
1158968309 18:62643126-62643148 GTCACCACTGGGGCCTCCAGAGG - Intergenic
1160808629 19:1003364-1003386 CCCCCCACTGGCGCCGCCATCGG - Exonic
1160841134 19:1147512-1147534 CACTCCAGTGGGGCCTCGAGGGG - Intronic
1160878922 19:1310849-1310871 GGCCCCACGGGGGCCTCCCTGGG - Intergenic
1161095567 19:2388512-2388534 GGCCCTTCTGGGGGCTCCAGGGG - Intergenic
1161107916 19:2453739-2453761 CGGTCCAATGGGGCGTCCAGTGG + Intronic
1161505313 19:4640457-4640479 GGCCCCCCTGGGGCCTCCCAAGG - Intronic
1161557998 19:4955265-4955287 GGCCCTCCTGGGGGCTCCAGGGG + Intronic
1161668375 19:5590481-5590503 TGCCACCCTGGGGCCTGCAGTGG - Intronic
1161968223 19:7560939-7560961 TGCACCACTGGGCCCCCCAGGGG + Intronic
1162489466 19:10983861-10983883 TGCCCCACAGGGGCCTTCAGGGG - Intronic
1162581867 19:11536218-11536240 CGCCCCTCCCGGGCCGCCAGGGG + Intergenic
1163320776 19:16573213-16573235 TCCTCCACTGGGGCCTCCTGGGG - Intronic
1165903282 19:39178626-39178648 CGCCCCACTGAGGCCAGTAGGGG + Exonic
1166793023 19:45409034-45409056 GTCCCCCCTGGGGACTCCAGAGG - Exonic
1167019149 19:46861254-46861276 CGCCCCGCTGCGGGGTCCAGGGG + Intergenic
1167377063 19:49118036-49118058 CACACCCCTGGGGCCTCCACGGG + Intronic
1202696066 1_KI270712v1_random:127515-127537 CCCCCCATTGGAGCCTTCAGAGG + Intergenic
925359620 2:3268243-3268265 GGCCCCACAGGTGCCTTCAGAGG - Intronic
925468449 2:4133370-4133392 CACCCCACTGTGGCCTGAAGGGG - Intergenic
926164105 2:10507420-10507442 AGCCCTGCTGGAGCCTCCAGGGG + Intergenic
926167582 2:10531122-10531144 CACACCACTGAGGCCACCAGTGG - Intergenic
927878801 2:26676095-26676117 CTGCCCACTGTGGCCTCCTGTGG - Intergenic
931852440 2:66265391-66265413 CATCCCACTGGAGTCTCCAGAGG - Intergenic
932667332 2:73708181-73708203 CCTGCCACTGTGGCCTCCAGTGG - Intergenic
932689497 2:73900255-73900277 CGCCCCACTGGGTCCTCCCAGGG + Intronic
934277234 2:91584551-91584573 CCCCCCATTGGAGCCTTCAGAGG + Intergenic
934735603 2:96688367-96688389 GACCCCACTGGGGCCTGCAGGGG - Intergenic
935688856 2:105712302-105712324 CACCCCCCTGGGGGTTCCAGTGG + Intergenic
936072540 2:109380871-109380893 TGCCCTGCTGGGGCCTCCAAAGG - Intronic
936462412 2:112722970-112722992 AGCCACACTGGGGCCTTCACTGG - Intronic
937521842 2:122721242-122721264 CACCCCCCTGGCACCTCCAGTGG + Intergenic
938994771 2:136666449-136666471 TGCCCCTCTGTGGCCTCCATGGG + Intergenic
940003802 2:148993224-148993246 CACCCCACTGGGCCCTCCTCTGG - Intronic
940331336 2:152478130-152478152 GGGCTCCCTGGGGCCTCCAGGGG + Intronic
948121951 2:235537280-235537302 CTCCCCACCTGGGCCTGCAGCGG - Intronic
948193150 2:236075608-236075630 TGCCCCTCAGTGGCCTCCAGGGG + Intronic
948424594 2:237878946-237878968 CAACCCTCTGGGGTCTCCAGGGG + Intronic
948854771 2:240724974-240724996 TGCCCACCTGGGGCCTCCTGTGG - Intronic
1169031127 20:2407942-2407964 CACTCTACTGGGGCATCCAGAGG + Intronic
1172916636 20:38448235-38448257 CACACACCTGGGGCCTCCAGGGG + Intergenic
1172939789 20:38646296-38646318 CGGCCCAGTGAGGCCACCAGGGG + Intronic
1173271458 20:41539552-41539574 CACCCCACTGGGGCCCCATGAGG + Intronic
1173609422 20:44355819-44355841 CGCGCCCCTCGGGGCTCCAGTGG + Intronic
1174194451 20:48763273-48763295 CGCCCATCTGGGGCCTGCATGGG + Intronic
1175171438 20:57084268-57084290 AGCCTCTCTCGGGCCTCCAGAGG + Intergenic
1175758448 20:61544985-61545007 AGCCCTACTGGGGCCCCGAGTGG + Intronic
1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG + Intronic
1179558037 21:42193185-42193207 GGCCCCCCTGGAGCCTCCTGCGG - Intergenic
1179640847 21:42746395-42746417 CCCTCCCCTGGGGCCTTCAGAGG - Intronic
1182431715 22:30302694-30302716 TGCCCAGCTGAGGCCTCCAGAGG - Intronic
1184148953 22:42627572-42627594 CCCCCCACTGAGGCGTCCGGCGG - Intronic
1184832140 22:46995691-46995713 CACGTCACTGGGGCCTCCCGAGG + Intronic
1185031189 22:48443799-48443821 CCTCCCTCTGGGGACTCCAGAGG + Intergenic
1185040564 22:48501724-48501746 CACACCCCTGGGGCCTCCAGGGG - Intronic
1185345345 22:50308270-50308292 CGCTCCCCTGCGGCCTTCAGGGG + Intergenic
949355866 3:3179785-3179807 TGCTCCCCTGGGGCCGCCAGGGG - Intergenic
949877423 3:8635339-8635361 GGCCTCCCTGGGGCCTCCAAAGG + Exonic
950428860 3:12939409-12939431 TGACCCACTGTGCCCTCCAGTGG - Intronic
950660375 3:14463516-14463538 AGCCCCGCAGGGGTCTCCAGAGG - Intronic
954782521 3:53071961-53071983 AGCACCACTGTGGCCTCAAGAGG + Intronic
956659520 3:71583907-71583929 CACCCCGCTGGGCACTCCAGCGG + Intronic
961330578 3:126135740-126135762 CGCCTCACTGGGGCCCCAGGAGG - Intronic
961825592 3:129597532-129597554 CGCCCCACTGGGGCCTTGCCGGG + Intronic
961874730 3:130013467-130013489 CTCCCCACCGGGGCCTTCTGCGG + Intergenic
964616566 3:158672701-158672723 CGCCCCACTACTGCCTGCAGCGG + Intronic
965596225 3:170413964-170413986 CGCCACACTTCAGCCTCCAGGGG + Intergenic
969361083 4:6664214-6664236 CGCCCCCCTGTCGCCTCCTGAGG + Intergenic
969497551 4:7534750-7534772 CTTGCCACTGGAGCCTCCAGAGG + Intronic
969526284 4:7705785-7705807 GGCCCCTCTGGGGCATTCAGGGG - Intronic
971159682 4:24121124-24121146 CACACCACTGGGACTTCCAGTGG + Intergenic
972960457 4:44447473-44447495 CACCCCCGCGGGGCCTCCAGCGG + Intronic
975312043 4:72913771-72913793 TGCCCCACTAGGGACTCTAGGGG - Intergenic
976223964 4:82780805-82780827 TGGCCCCCTGGGGCCTCCTGGGG - Intronic
977558325 4:98506919-98506941 CCCCCTACTGAGGCCACCAGTGG - Intronic
982668180 4:158291609-158291631 CTCCCCACTGAGGCCTCAGGAGG + Intergenic
984163996 4:176286227-176286249 CTCCCCTCTGTGTCCTCCAGAGG - Intergenic
984787532 4:183582809-183582831 TGCCCCACTGATGCCTCCACTGG + Intergenic
985563092 5:601835-601857 CCCCTCACTGGGGCTCCCAGGGG - Intergenic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
986451472 5:7869444-7869466 CGCCGCCCAGGGGCCTCCCGCGG - Intronic
988085770 5:26473706-26473728 CACCTGACTGGGGCCTTCAGTGG + Intergenic
989229046 5:39066007-39066029 TGCCCCACTGGGGACTCTGGGGG + Intronic
994106820 5:95959094-95959116 CTCCCTTCTGGGGCCTCCAGTGG + Intronic
997897907 5:137736191-137736213 GGCCCCTCTGTGGCCTGCAGTGG + Intergenic
1001406524 5:171480999-171481021 CGCCCCACCTGGGGCTCCACTGG + Intergenic
1002432294 5:179210648-179210670 AGCACCACTGAGGCTTCCAGGGG - Intronic
1003198192 6:3933278-3933300 CTGTCCACTGGGGCCACCAGAGG - Intergenic
1004702579 6:18092975-18092997 AGCCGCACTGAGGCCTGCAGTGG + Intergenic
1005626619 6:27668654-27668676 GGCCCCACTATGGCATCCAGTGG - Intergenic
1006677847 6:35776877-35776899 CTCCCCTCTGAGGCCACCAGGGG - Intronic
1007615924 6:43179783-43179805 CGCTCCCCTTGGACCTCCAGGGG + Exonic
1007806853 6:44456838-44456860 AGCCCTAGTGGGGGCTCCAGGGG + Intergenic
1012818722 6:104057798-104057820 CCCCCAACTGGGGCCTCCCCAGG - Intergenic
1013350505 6:109301608-109301630 CACCCCACTGTGTCCTCCACTGG + Intergenic
1019143996 6:169965126-169965148 CACCCCACAGGAGCCTGCAGGGG + Intergenic
1019167935 6:170111207-170111229 CACCCCACTGTGGGCTCCAGAGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019570214 7:1707942-1707964 GCCCCCACTAGGGCCTCCTGAGG + Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1022983190 7:35624335-35624357 TGCCCCTCTGGGGGCTGCAGAGG - Intergenic
1023338769 7:39197179-39197201 AGCCACACTGAGGCTTCCAGGGG - Intronic
1023401107 7:39793375-39793397 TGCCCCACCGCGGCCTCCCGGGG - Intergenic
1024075089 7:45814034-45814056 CGCCCCACCGCGGCCGCCCGGGG - Intergenic
1024648506 7:51387306-51387328 CGCCCCACTGCGGCCTCCCGGGG + Intergenic
1025052358 7:55741775-55741797 CGCCCCACCGCGGCTTCCCGGGG + Intergenic
1025129313 7:56367458-56367480 CCCCCCACTGCGGCCTCCCGGGG + Intergenic
1025130029 7:56370309-56370331 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130335 7:56371559-56371581 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130655 7:56372857-56372879 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025130971 7:56374151-56374173 CGCCCCACCACGGCCTCCCGCGG + Intergenic
1025176420 7:56804522-56804544 CGCCCCACGGTGGCCTCCTGGGG + Intergenic
1025695369 7:63771864-63771886 CACCCCACGGTGGCCTCCTGGGG - Intergenic
1026841294 7:73671215-73671237 CTGCCCACTGGGGCCGCCCGGGG + Exonic
1026857060 7:73762090-73762112 GGCACCCCTGGGGCCTCCTGGGG - Intergenic
1027228233 7:76258208-76258230 CTCCCCTCTGCAGCCTCCAGGGG - Intronic
1028477093 7:91264833-91264855 CGCTCCGCTGGGGCTGCCAGGGG - Exonic
1030682710 7:112450336-112450358 CGCCCGACGGAGGCGTCCAGTGG + Intronic
1031629874 7:124033103-124033125 CGCCCCCCGGGGGCCGGCAGCGG - Intergenic
1032425004 7:131815529-131815551 CCCCCCACTGGTGACTCCATGGG + Intergenic
1032495205 7:132356194-132356216 TTCCCAACTGGGCCCTCCAGTGG + Intronic
1033241511 7:139683441-139683463 CTCCCTACGGGGGCCTCCACAGG + Intronic
1034488815 7:151382081-151382103 CGCCCCACGGGGGTATCCTGAGG + Intronic
1035400084 7:158558991-158559013 GGCCACACTGGGGGGTCCAGAGG + Intronic
1042466727 8:69136521-69136543 CTCCTCACTGGGGCTTGCAGAGG + Intergenic
1049791813 8:144475717-144475739 CTCCCGCCTGGGGCCCCCAGAGG - Exonic
1053056550 9:34996399-34996421 CGCTCCACTCGGCCCTTCAGTGG + Exonic
1056488289 9:87081017-87081039 TGCCCCACTGGGGCCACCTATGG + Intergenic
1056934863 9:90908781-90908803 TGCCCCTCTGGGGCGTGCAGAGG + Intergenic
1057192164 9:93094370-93094392 GCCCCCTCTGGGTCCTCCAGGGG + Intergenic
1058256947 9:102778224-102778246 AGCCCCACAGCAGCCTCCAGAGG - Intergenic
1059842183 9:118230070-118230092 GGCCCCACTGGGCCCTCCTAAGG - Intergenic
1060894351 9:127208164-127208186 TGCTCCACTGGGGCCACCAAGGG + Intronic
1185750924 X:2609224-2609246 CGCCCCACCCCGGCCTCCACTGG - Intergenic
1188007148 X:25023077-25023099 CGCGCCATTGGGGCCACCGGGGG - Intergenic
1188793715 X:34437360-34437382 TTCCCTACAGGGGCCTCCAGTGG + Intergenic
1189753899 X:44251368-44251390 CGACCCACTGTGGCCTCCCAAGG - Intronic
1190321914 X:49184701-49184723 CCGCCCACTGCAGCCTCCAGAGG - Exonic
1191694843 X:63978951-63978973 TGCCCCAGTGGGGACTCTAGCGG + Intergenic
1196679207 X:118453676-118453698 CGGCCCACTGCAACCTCCAGAGG - Intergenic
1196746259 X:119073697-119073719 CGCCGCACTGCGGCGCCCAGTGG + Intergenic
1199615184 X:149650276-149650298 TGCTCCTCTGGGGCCTCCTGGGG + Intergenic
1199628360 X:149760198-149760220 CCCCTACCTGGGGCCTCCAGGGG - Intergenic
1199635426 X:149808031-149808053 TGCTCCTCTGGGGCCTCCTGGGG - Intergenic
1199948017 X:152682845-152682867 TGCTCCTCTGGGGCCTCCTGGGG - Intergenic
1199961662 X:152785609-152785631 TGCTCCTCTGGGGCCTCCTGGGG + Intergenic