ID: 1176019842

View in Genome Browser
Species Human (GRCh38)
Location 20:62957002-62957024
Sequence CGCCCCACTGGGGCCTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176019826_1176019842 8 Left 1176019826 20:62956971-62956993 CCATCTTCCCCATCTCCTGGCTG 0: 1
1: 1
2: 9
3: 98
4: 819
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019825_1176019842 9 Left 1176019825 20:62956970-62956992 CCCATCTTCCCCATCTCCTGGCT 0: 1
1: 0
2: 7
3: 75
4: 584
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019835_1176019842 -7 Left 1176019835 20:62956986-62957008 CCTGGCTGGTGGGGGCCGCCCCA 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019834_1176019842 -1 Left 1176019834 20:62956980-62957002 CCATCTCCTGGCTGGTGGGGGCC 0: 1
1: 0
2: 3
3: 27
4: 399
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019823_1176019842 28 Left 1176019823 20:62956951-62956973 CCTCGGGGATCGGTAACTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019833_1176019842 0 Left 1176019833 20:62956979-62957001 CCCATCTCCTGGCTGGTGGGGGC 0: 1
1: 0
2: 3
3: 19
4: 273
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218
1176019831_1176019842 1 Left 1176019831 20:62956978-62957000 CCCCATCTCCTGGCTGGTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 344
Right 1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG 0: 1
1: 0
2: 2
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176019842 Original CRISPR CGCCCCACTGGGGCCTCCAG GGG Intronic