ID: 1176021793

View in Genome Browser
Species Human (GRCh38)
Location 20:62965995-62966017
Sequence CTCCATGAAGACGGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176021788_1176021793 -10 Left 1176021788 20:62965982-62966004 CCTGCACTGGGTCCTCCATGAAG 0: 1
1: 1
2: 0
3: 22
4: 225
Right 1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 166
1176021784_1176021793 20 Left 1176021784 20:62965952-62965974 CCCACAGCACTTTACTCTAAGGA 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 166
1176021785_1176021793 19 Left 1176021785 20:62965953-62965975 CCACAGCACTTTACTCTAAGGAG 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 166
1176021782_1176021793 21 Left 1176021782 20:62965951-62965973 CCCCACAGCACTTTACTCTAAGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG 0: 1
1: 0
2: 0
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176021793 Original CRISPR CTCCATGAAGACGGGCAGCT GGG Intronic
900833340 1:4980602-4980624 CTCCCTGAGGAGGGGCAGCTGGG + Intergenic
901066490 1:6497056-6497078 CCCCAGGAAGAGAGGCAGCTTGG - Exonic
902124864 1:14200892-14200914 CTCCATGGAGCCAGCCAGCTGGG - Intergenic
907472113 1:54680595-54680617 CTCCCTGAAGACAGTGAGCTTGG - Intronic
911177046 1:94827319-94827341 ATCCATGAAGCTGTGCAGCTTGG - Intronic
914050322 1:144125725-144125747 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
914128860 1:144839720-144839742 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
917234331 1:172874068-172874090 GTCCATGAAGAAGGCCAGCCTGG - Intergenic
918327863 1:183427336-183427358 CTCCCAGACGATGGGCAGCTGGG - Intergenic
920333482 1:205228561-205228583 CACCATGAAGAGGTGCAGATCGG + Exonic
921791601 1:219296568-219296590 CACCCTGAAGACGGGTAGCTGGG + Intergenic
1063618362 10:7622050-7622072 CTGCATGAAGACAGGAAGATGGG - Intronic
1065806557 10:29398579-29398601 CCCAAAGAAGAAGGGCAGCTGGG - Intergenic
1067752853 10:48983373-48983395 CTCCAGGAAGAACTGCAGCTCGG - Intergenic
1069714936 10:70514589-70514611 CTCCATGAAGCCTGTCACCTGGG + Intronic
1070630105 10:78078472-78078494 TTCCATAAAGAGGGGGAGCTTGG - Intergenic
1071970104 10:90896370-90896392 CTCCATGGAGAAGCGCTGCTCGG - Exonic
1073850605 10:107612978-107613000 CTGCAGGAAGAGGGGTAGCTGGG - Intergenic
1074869971 10:117568685-117568707 CTCCAGGGAGAGGGCCAGCTGGG + Intergenic
1074974954 10:118572627-118572649 CTCCATGGATACTGGCAGGTTGG - Intergenic
1076504574 10:130963276-130963298 CTCTGGGCAGACGGGCAGCTGGG + Intergenic
1077113790 11:873619-873641 CTCAATGAACACGGACAGCTCGG + Intronic
1077123430 11:921633-921655 CTCAAAGGAGAAGGGCAGCTCGG - Intergenic
1077299926 11:1842128-1842150 CTCCCTGAGGAGGGGCAGCTTGG - Intergenic
1077343066 11:2034619-2034641 CTCCCTGATGACGGGAACCTGGG + Intergenic
1078526842 11:12107960-12107982 CTCCAGGAAGATGGTCAGCAAGG + Intronic
1078899602 11:15629260-15629282 CCCCTTGAAGACTGGCATCTTGG - Intergenic
1079403969 11:20128971-20128993 CTCCACGAAGGCAGGCTGCTTGG - Intergenic
1081254500 11:40875745-40875767 TTCCATGAACTCGGGCAGGTGGG + Intronic
1081870208 11:46379871-46379893 CTCCAGGTAGGCGGCCAGCTCGG - Exonic
1083708666 11:64534071-64534093 CTCCATGAAGACCTGAGGCTGGG - Intergenic
1084084871 11:66850360-66850382 CACCATGAAGTCTGGCAACTCGG - Exonic
1089398260 11:118149756-118149778 CTCCTTGAGGACTGGCAGCAGGG + Intronic
1089488501 11:118865753-118865775 CTCCATGAAGACTTGAAGATAGG + Intergenic
1089785287 11:120903205-120903227 CTGGATGCAGACAGGCAGCTGGG - Intronic
1202826052 11_KI270721v1_random:89808-89830 CTCCCTGATGACGGGAACCTGGG + Intergenic
1092109799 12:5951454-5951476 CTTCTTGAAGACAGGCACCTTGG - Intronic
1096403110 12:51323835-51323857 TTCCATGAAAACTGGCAGATTGG - Intronic
1102076897 12:110066901-110066923 CTCCATGGCGACGGCCAGCCTGG + Intronic
1103368402 12:120399977-120399999 CTCCATGAGGACAGGGACCTTGG + Intergenic
1103982094 12:124743095-124743117 CTCCATGAAGAAGGAAAGCTGGG - Intergenic
1104859231 12:131916098-131916120 CTGCAGGAAGTCGGGCAGCTTGG - Exonic
1110136538 13:72074209-72074231 CTCCTTGAAGCCGTGCTGCTGGG - Intergenic
1110749712 13:79098498-79098520 CTCAATGAAGTCAGGAAGCTGGG + Intergenic
1113616836 13:111686200-111686222 CTCCGTGGAGCCGGGCAGCCCGG - Intergenic
1113622366 13:111771471-111771493 CTCCGTGGAGCCGGGCAGCCCGG - Intergenic
1114621618 14:24099479-24099501 CTGCATGGGGAAGGGCAGCTAGG - Intronic
1114671722 14:24415216-24415238 CTCCAGGCGGAAGGGCAGCTGGG - Exonic
1116053822 14:39838792-39838814 GACCATGAAGAAGGGCAGCATGG + Intergenic
1119478447 14:74945423-74945445 CTCCATGAAGACAGGGATCCTGG - Intronic
1121111486 14:91316085-91316107 CTCCAGGAGGACAGGAAGCTGGG - Intronic
1122740629 14:103869792-103869814 GTCCATGAAGAGGGGCAGCAGGG - Intergenic
1123420197 15:20125034-20125056 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
1123445664 15:20328498-20328520 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
1123529421 15:21131570-21131592 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
1124689782 15:31812224-31812246 CTCCCTGAACAGGGTCAGCTGGG - Intronic
1128757183 15:70191078-70191100 CTCCCTGCAGATGGGCAGCAGGG - Intergenic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1136016144 16:27402412-27402434 CACTCTGATGACGGGCAGCTGGG - Exonic
1136721078 16:32320108-32320130 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
1136839462 16:33526394-33526416 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
1137548313 16:49419059-49419081 CCCCATGCAGGCGGGCATCTTGG + Intergenic
1137597649 16:49735472-49735494 CTCCCTGCAGAAGGGCAGGTGGG - Intronic
1140296255 16:73712310-73712332 CCCAAGGAAGAAGGGCAGCTTGG - Intergenic
1141991579 16:87613967-87613989 CTCCATCAAGAAAGGCATCTCGG - Intronic
1203005354 16_KI270728v1_random:197662-197684 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
1203136904 16_KI270728v1_random:1733783-1733805 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
1203149626 16_KI270728v1_random:1826679-1826701 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
1145291636 17:21551364-21551386 CGCCATGCAGACGGGAAGCTTGG - Exonic
1145388432 17:22435664-22435686 CGCCATGCAGACGGGAAGCTCGG + Intergenic
1151835913 17:76582710-76582732 GTCCAGGAAGATGGGCATCTGGG - Intronic
1154483108 18:14855957-14855979 CTCCCAGATGATGGGCAGCTGGG + Intergenic
1154483468 18:14857356-14857378 CTCCCAGATGATGGGCAGCTGGG + Intergenic
1154483530 18:14857580-14857602 CTCCCAGATGATGGGCAGCTGGG + Intergenic
1154483888 18:14858976-14858998 CTCCCAGATGATGGGCAGCTGGG + Intergenic
1154483951 18:14859200-14859222 CTCCCAGATGATGGGCAGCTGGG + Intergenic
1157383828 18:47246704-47246726 CTGCAGGAAGACGGGAAACTCGG - Intronic
1157502294 18:48200096-48200118 CTCCAAGAATACTGGCAGCCAGG - Intronic
1157578821 18:48761490-48761512 CTCCATGAAGGTGGTGAGCTTGG - Exonic
1160076202 18:75680038-75680060 CTCCAGGATGATGGGCACCTGGG + Intergenic
1162029775 19:7912409-7912431 CTACCTGAAGAAGGGCAGGTGGG - Exonic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1162967648 19:14163639-14163661 TTCCAGGGAGAGGGGCAGCTGGG - Intronic
1166332812 19:42088568-42088590 CTCCGAGAAGACAGGCAGCATGG - Intronic
1202689729 1_KI270712v1_random:78363-78385 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
925457456 2:4028040-4028062 TTCCAGGAAGACAGGCAGCCTGG - Intergenic
927418517 2:22904598-22904620 CTCCATCAAGATGGCCAGCAAGG + Intergenic
933868941 2:86548949-86548971 CTCCCAGATGATGGGCAGCTGGG + Intronic
933956691 2:87377659-87377681 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
934240835 2:90269686-90269708 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
934272358 2:91547073-91547095 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
934772601 2:96916867-96916889 CCCCAGGAAGAAGGGCAGATTGG - Intronic
935296111 2:101651063-101651085 CTCCAAGAACACAGGCAGCCAGG + Intergenic
936148401 2:109996984-109997006 CTCCAGGAAGACGTGCAGGTGGG + Intergenic
936196276 2:110374384-110374406 CTCCAGGAAGACGTGCAGGTGGG - Intergenic
936543267 2:113369214-113369236 CTCCATGAAGACTGGCAAGGGGG + Intergenic
937983998 2:127630468-127630490 CCCCATGGAGAAGGGGAGCTGGG + Intronic
940898944 2:159108724-159108746 CTCCAGGCAGAGGGGCAGCCAGG + Intronic
941851065 2:170181020-170181042 CTCCATGATGATGGGCCTCTAGG + Intronic
946779185 2:223175578-223175600 GGCCATGAGGATGGGCAGCTGGG - Intronic
947034776 2:225839749-225839771 CTTCATGGAGACTGGCAGCTGGG - Intergenic
1175278905 20:57789394-57789416 CTCCATGCAGACGGGGCGCAAGG - Intergenic
1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG + Intronic
1176728294 21:10462950-10462972 CTCCATTAAAACGTGCAGGTTGG + Intergenic
1176797494 21:13380620-13380642 CTCCCAGACGATGGGCAGCTGGG - Intergenic
1179553319 21:42156953-42156975 CTCCTAGAATGCGGGCAGCTGGG + Intergenic
1179988845 21:44935361-44935383 CTCCCTGAAGGTGGGCACCTGGG + Intronic
1180551692 22:16546200-16546222 CTCCAGGAAGACCTGCAGGTGGG - Intergenic
1181084623 22:20433791-20433813 CTCCCTGCAGATGGGCACCTTGG - Intronic
1181352315 22:22267723-22267745 CTCCAGGAAGACCTGCAGGTGGG + Intergenic
1181811484 22:25405827-25405849 CTGCATGAAGCTGGCCAGCTGGG + Intergenic
1183103408 22:35598049-35598071 CTCCAGGAAGACTACCAGCTGGG + Intergenic
1184936286 22:47724713-47724735 CTCCAGGAAGAGGGGCATGTAGG + Intergenic
1185220807 22:49628245-49628267 CTCCAGGATGAGAGGCAGCTGGG + Intronic
1185316328 22:50180808-50180830 CTCCTTGAAGACAGGTGGCTGGG + Intergenic
950015408 3:9751526-9751548 CTCCATGAGGACTGGCATTTGGG - Intronic
950211494 3:11126826-11126848 CTCCAGGCAGAGGGGCAGCATGG + Intergenic
950277237 3:11672956-11672978 CTCCCTGAAGTCTGGAAGCTGGG - Intronic
952669365 3:35947832-35947854 CTCCTTGGAGAAGGGCAGCGAGG + Intergenic
953809210 3:46097425-46097447 CGACATGAAGACAGGCAGGTGGG + Intergenic
955692980 3:61608225-61608247 CTCCATAAAGCTGAGCAGCTAGG + Intronic
955751738 3:62190362-62190384 CTCCATGAAGGCAGGCAGCACGG + Intronic
958406438 3:93761893-93761915 CTCCCAGATGATGGGCAGCTGGG + Intergenic
958407045 3:93764032-93764054 CTCCCAGAAGATGGGCGGCTGGG + Intergenic
959568239 3:107854653-107854675 CTCCATGGAGATGGTCAGCAAGG - Intergenic
960724137 3:120653394-120653416 CTCCATGAAACGTGGCAGCTGGG - Intronic
961166311 3:124766230-124766252 CTCCCTGAGGACGGTCAGGTTGG + Exonic
961490228 3:127252167-127252189 CTCCCTGAAGAAGGGAGGCTGGG + Intergenic
962203956 3:133420047-133420069 CTCCGTGGAGACTGGCATCTTGG - Intronic
964485121 3:157178805-157178827 CTCCCAGAAGAAGGGCGGCTGGG + Intergenic
968552320 4:1229947-1229969 CTCCAGGAAGAAGGGAAGGTTGG + Intronic
969538225 4:7769797-7769819 TACCATGAAAATGGGCAGCTCGG + Intronic
970456273 4:16226743-16226765 CTCCATGCAGCCGGGCTGCGCGG + Intronic
980492280 4:133543521-133543543 CTTCATGAAGACTGGCACCCAGG + Intergenic
981217931 4:142193142-142193164 ATCCCTGAAAATGGGCAGCTGGG + Exonic
982692158 4:158560869-158560891 CACCAAGAAGCCGGCCAGCTGGG + Intronic
985585236 5:729033-729055 CTCCATGATCCAGGGCAGCTGGG + Intronic
985598747 5:813360-813382 CTCCATGATCCAGGGCAGCTGGG + Intronic
986204860 5:5613962-5613984 CTCCAGGGAGACTGGCAGCTGGG - Intergenic
990709152 5:58563445-58563467 CTCCCAGACGATGGGCAGCTGGG + Intergenic
992625198 5:78630535-78630557 GACCATGAAGAGGGTCAGCTGGG + Intronic
997266102 5:132496279-132496301 TTCCAGGAAGCCGGCCAGCTTGG - Intergenic
998129768 5:139645843-139645865 CCCCAAGAAGAAGGGAAGCTTGG - Intergenic
999096537 5:148983300-148983322 CTCTCTGAAGAGGGGCACCTGGG + Intronic
999195366 5:149778170-149778192 CTCCATGGATACGAGCAGCCAGG - Intronic
1000475701 5:161704272-161704294 CTTCTTGAAGAAGGGCTGCTTGG + Intergenic
1006865073 6:37202650-37202672 CTCAATGGAGATGGGCAGCCAGG - Intergenic
1007116738 6:39348391-39348413 CTGCATGAGGTGGGGCAGCTGGG - Intronic
1007246535 6:40467339-40467361 CTCCAAGGACACAGGCAGCTGGG - Intronic
1013582074 6:111545485-111545507 GTCCCTGAAGAGGGTCAGCTTGG - Intergenic
1015952314 6:138565543-138565565 CTCTATGAGGACGGACATCTAGG + Intronic
1017011346 6:150065788-150065810 CTCCATGAAGCCCAGCAGCAAGG - Intronic
1020363332 7:7353429-7353451 ATGCAGGAAGAGGGGCAGCTAGG - Intergenic
1023937453 7:44749528-44749550 CCCCATCAAAACTGGCAGCTGGG - Intronic
1024253287 7:47522013-47522035 CTCCAGGAAGAAGGCCAGCAAGG + Intronic
1025988297 7:66474695-66474717 CTCCATGCAGCCGGGCTGCGCGG - Intergenic
1027882034 7:83852310-83852332 CTACATGAACACCGGCAGCTGGG + Intergenic
1029105242 7:98169668-98169690 CTCCAGGACTACAGGCAGCTGGG - Intronic
1031674555 7:124592922-124592944 CTCCAGGAAGAGGGGCTGCCTGG + Intergenic
1034601803 7:152265073-152265095 CTCCATTAAAACGTGCAGGTTGG - Exonic
1035717790 8:1767034-1767056 CTCCAGGAAGACTGGGCGCTTGG + Intronic
1036701372 8:11015961-11015983 CTCCATGAGGGCGGGCAGCAGGG + Intronic
1037670336 8:21010175-21010197 CTGCATGAAGACAGTCAGCCTGG + Intergenic
1038453825 8:27658525-27658547 TGCCATGAAGCTGGGCAGCTGGG + Exonic
1041797077 8:61756641-61756663 CGCCATGCAGCAGGGCAGCTGGG - Intergenic
1042945306 8:74148097-74148119 CTCCAGGAAGATGGGCAAGTGGG - Intergenic
1046528084 8:115407277-115407299 CTCCATGGATACAGCCAGCTGGG - Intergenic
1047992413 8:130299521-130299543 CTCCATGCAGGCTGTCAGCTAGG + Intronic
1048230983 8:132641419-132641441 CTCCATGAAGAGGGGAAGATTGG + Intronic
1052880846 9:33600149-33600171 CTCCAGGAATCCTGGCAGCTTGG + Intergenic
1052974851 9:34402757-34402779 CTCCCTGAAGAATGGCAGCATGG - Exonic
1053495118 9:38544061-38544083 CTCCAGGAATACTGGCGGCTTGG - Intronic
1056327062 9:85488931-85488953 CTCCATGAAGGCAGGAAGCTGGG + Intergenic
1056509160 9:87286343-87286365 CTCCATGAAGTCGGTCAGTTGGG - Intergenic
1056735121 9:89202987-89203009 CTCCATGTATACAGCCAGCTTGG + Intergenic
1057230327 9:93317782-93317804 CTGCAAGAAGACTGGCAGCACGG - Intronic
1058093957 9:100837572-100837594 ACCCATGAAGATGGGCAGTTTGG - Intergenic
1058625848 9:106932079-106932101 CTGCATGAAGAATGGCAGTTGGG + Intronic
1058762376 9:108147565-108147587 CTCAATGGAGAGGGCCAGCTTGG + Intergenic
1061035973 9:128114604-128114626 CTGGAGGAAGAAGGGCAGCTGGG - Intergenic
1061544830 9:131298612-131298634 CTGCGGGAAGAGGGGCAGCTGGG - Intronic
1062036213 9:134383745-134383767 CTGCATGAGGACGGGTAGGTGGG + Intronic
1188770422 X:34147416-34147438 CTCCAGGAAGTCGCACAGCTGGG - Intergenic
1189014133 X:37077998-37078020 CTCCAGGAAGTCGCACAGCTGGG + Intergenic
1190055386 X:47178457-47178479 CAGCATGAAGAGGGGCAGGTCGG - Intronic
1190756934 X:53409344-53409366 CTGCATGAAGAGGGGCATGTAGG + Intronic