ID: 1176022369

View in Genome Browser
Species Human (GRCh38)
Location 20:62968297-62968319
Sequence CGCCATGGCCATGCTGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176022369_1176022375 -2 Left 1176022369 20:62968297-62968319 CCCTGCCCAGCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 30
4: 238
Right 1176022375 20:62968318-62968340 CGCAGGCTCTCGAACCCGCATGG 0: 1
1: 0
2: 2
3: 1
4: 35
1176022369_1176022382 30 Left 1176022369 20:62968297-62968319 CCCTGCCCAGCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 30
4: 238
Right 1176022382 20:62968350-62968372 GCCTGGTGATTCTGCTCTCCAGG 0: 1
1: 0
2: 0
3: 23
4: 173
1176022369_1176022376 8 Left 1176022369 20:62968297-62968319 CCCTGCCCAGCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 30
4: 238
Right 1176022376 20:62968328-62968350 CGAACCCGCATGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1176022369_1176022379 13 Left 1176022369 20:62968297-62968319 CCCTGCCCAGCATGGCCATGGCG 0: 1
1: 0
2: 1
3: 30
4: 238
Right 1176022379 20:62968333-62968355 CCGCATGGCTTTCCCAGGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176022369 Original CRISPR CGCCATGGCCATGCTGGGCA GGG (reversed) Exonic
900185757 1:1332470-1332492 CGGCATGGCCCAGATGGGCACGG + Exonic
900530665 1:3151423-3151445 GCCCATGGCCTGGCTGGGCAAGG - Intronic
901148861 1:7087036-7087058 CGCCATGAACATGCTGAGCTTGG + Intronic
901180233 1:7336673-7336695 CGCCCTGGCCTTGCTGGGCTAGG - Intronic
902078563 1:13805822-13805844 CGCCATGGGCATCCTGGGCTGGG - Intronic
902255916 1:15188503-15188525 GGGTATGGCCATGCTGGGCTGGG - Intronic
903017433 1:20370136-20370158 CCCCAGGCCCATGCTGGCCAAGG + Intergenic
903541807 1:24100594-24100616 CTCCATGTCCAGGCCGGGCACGG + Intronic
903828337 1:26160701-26160723 CCCGATGGCCCTGCTGGGCCTGG + Intronic
903847934 1:26289600-26289622 GGGCATCGCCATGATGGGCAGGG - Intronic
904361412 1:29975053-29975075 CATCATGGCCATGGTGGGGAAGG - Intergenic
904576560 1:31508900-31508922 AGACCTGGCCAGGCTGGGCAGGG + Intergenic
906705287 1:47890338-47890360 CTCCATGACCACGCTGGTCATGG - Intronic
911072802 1:93846238-93846260 AGGCCTGGCGATGCTGGGCAGGG + Intronic
912656413 1:111489879-111489901 TGCCATGGTCAAGCTGGACATGG - Intronic
914975079 1:152353797-152353819 AGACATGGCCATTCTGGTCATGG - Exonic
916713631 1:167432785-167432807 TGCCATGGCCAAGCAAGGCATGG + Intronic
917176880 1:172245475-172245497 GGCCCTTGCCATGCTGGCCATGG + Intronic
920096047 1:203487407-203487429 CGCCCTGGCCCTGCTGGCCCGGG + Exonic
922748850 1:228061490-228061512 CCCCAGGGCCGTGATGGGCAGGG + Intergenic
924837873 1:247672601-247672623 AGCCATGACCATGCTGAGCAAGG + Exonic
1063449423 10:6141497-6141519 CGCCACAGCCGTGCTGGTCAGGG - Intergenic
1066442181 10:35449435-35449457 AGCAATGGCCCTACTGGGCAGGG + Intronic
1069993247 10:72327911-72327933 CGCCATGGACACGCTAGGCCAGG - Intergenic
1070644241 10:78190428-78190450 CACCATGTCAAGGCTGGGCAAGG + Intergenic
1073258546 10:102171416-102171438 TTACATGGTCATGCTGGGCACGG - Intergenic
1074550865 10:114440987-114441009 TCCCATGGCCAGGCTGAGCATGG - Intronic
1076890485 10:133280879-133280901 GGCCAGGGCGGTGCTGGGCAGGG + Intronic
1076890521 10:133281003-133281025 AGCCAGGGCGGTGCTGGGCAGGG + Intronic
1076890543 10:133281073-133281095 GGCCAGGGCAGTGCTGGGCAGGG + Intronic
1076890578 10:133281197-133281219 AGCCAGGGCGGTGCTGGGCAGGG + Intronic
1077370907 11:2181195-2181217 CCCCAAGGCCATGCTGGGGTGGG - Intergenic
1077392868 11:2308099-2308121 TGCCCTGCCCCTGCTGGGCAGGG + Intronic
1083970327 11:66070470-66070492 CGCCATGGCCCGGCTAGGCGGGG - Exonic
1084336373 11:68460339-68460361 CTCCACGGCCATGATGGGCTTGG + Intergenic
1084605672 11:70170227-70170249 CCCCCTGCCCATGCTGGGAAGGG - Intronic
1084757212 11:71247540-71247562 TGCCATGGCCCTGCTGGGCTGGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085515758 11:77110990-77111012 ACCCCTGGCCCTGCTGGGCACGG - Intronic
1085649606 11:78255735-78255757 CTACATGGCCATTCTGGACAGGG + Intronic
1086967937 11:93049467-93049489 TGCCACGGTCATTCTGGGCATGG - Intergenic
1087293233 11:96341640-96341662 CCCCCTGGCCATGCTGTACAAGG + Exonic
1089684720 11:120139401-120139423 CTCCAAGGCCAGGCTGGGCAGGG + Intronic
1091397688 12:163668-163690 CGCCCTGGTCAGCCTGGGCAGGG + Intronic
1092183634 12:6462942-6462964 GGCTGAGGCCATGCTGGGCAGGG - Intronic
1093980029 12:25465966-25465988 CACCATGGCCATACTGCCCAAGG - Intronic
1095358484 12:41306232-41306254 TACCATGGCTCTGCTGGGCAGGG + Intronic
1098851026 12:75596241-75596263 CGCCATTGACATTTTGGGCAAGG + Intergenic
1101122462 12:101597332-101597354 GGTCATGGCCTTCCTGGGCATGG - Intronic
1101608549 12:106269194-106269216 AGCCATGGAGATGCTGGGCCTGG - Intronic
1102591206 12:113958151-113958173 GGCCATGGACACGGTGGGCATGG - Intronic
1103772070 12:123335147-123335169 CGCCACTGCCTGGCTGGGCATGG + Intronic
1105246108 13:18651716-18651738 CTCAAAGGCAATGCTGGGCAGGG - Intergenic
1106791204 13:33156270-33156292 AGCCCTGGCCATGTTGGGCACGG + Intronic
1107653407 13:42567776-42567798 AGCTATGGCCATGCCAGGCAAGG + Intronic
1107767224 13:43749501-43749523 AGCCATGGAAATGCTGGGCTTGG + Intronic
1108417239 13:50210559-50210581 CACCATATCCAGGCTGGGCATGG - Intronic
1110029169 13:70584187-70584209 CGCCATTGGCAAGCTGGGCTGGG - Intergenic
1111595532 13:90404988-90405010 TGCCAAGGACATGCTAGGCATGG - Intergenic
1112492591 13:99880778-99880800 GGCCAGGGCCATGAGGGGCACGG - Intronic
1113789440 13:113019812-113019834 AGGCATGGCCATGCTGCGGAAGG - Intronic
1113871717 13:113563949-113563971 TGTCGTGGCCATGCTGGACACGG + Intergenic
1115006523 14:28492122-28492144 CACCATGGCTCTGCTGGGCTCGG + Intergenic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1117111510 14:52461679-52461701 CCTCATGGCCATGCTGGGAGTGG - Intronic
1118816420 14:69317429-69317451 CTCCATGGCCAAGCCTGGCATGG + Intronic
1120458724 14:84765960-84765982 AGCTATGACCAGGCTGGGCATGG - Intergenic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1122148215 14:99706764-99706786 CGCCATGGACATCCTGGCCAAGG + Exonic
1123705862 15:22950794-22950816 CGGTATGGCCAGGCTGGTCAAGG + Intronic
1125329029 15:38564610-38564632 GGCCATGGGCACCCTGGGCAAGG - Exonic
1125758697 15:42083099-42083121 GGCCTTGGCCCTGGTGGGCAGGG + Intronic
1132292799 15:100714891-100714913 CGCCATGGGGATGCTGGGGGTGG + Intergenic
1132549555 16:548699-548721 GGCCCTGGCCCTGCTGGGGAGGG - Intronic
1132750271 16:1454405-1454427 CGCCATGGGCGTGGTGGGTAAGG - Exonic
1133250422 16:4476819-4476841 CGTCACGGCTATGCTGGGCGAGG + Intronic
1135111078 16:19691294-19691316 CCCCGCGGCCATGCTGGCCAGGG - Intronic
1136113478 16:28079605-28079627 CGGCATGGCTTGGCTGGGCAGGG + Intergenic
1136141900 16:28293396-28293418 CTCCATGGCGACGCTGGGGAAGG - Intronic
1136233716 16:28902484-28902506 GGCCATGGACAGGCTGGCCAAGG - Intronic
1140250923 16:73293659-73293681 AGGCATGGCCATGCTGGCCTGGG - Intergenic
1141761911 16:86034133-86034155 TGCCATTGCCAGGCTGGGCAAGG + Intergenic
1141809813 16:86368335-86368357 CGCCATGGCCGTTCTGGACGGGG - Intergenic
1142496756 17:310115-310137 AGCCATGGGGAGGCTGGGCAGGG - Intronic
1143487314 17:7261989-7262011 CTCCATGGCCCTGCTGGGCTGGG - Exonic
1144742896 17:17594020-17594042 AGCCTGGGCCAGGCTGGGCATGG + Intergenic
1146860241 17:36291221-36291243 AACCATGACCAGGCTGGGCATGG - Intronic
1147090567 17:38095315-38095337 AACCATGACCAGGCTGGGCATGG - Intergenic
1147106646 17:38225211-38225233 AACCATGACCAGGCTGGGCATGG + Intergenic
1147576518 17:41603373-41603395 ACCCATGCCCAGGCTGGGCATGG + Intergenic
1147576520 17:41603375-41603397 CACCATGCCCAGCCTGGGCATGG - Intergenic
1148109226 17:45135478-45135500 CGCCTTGGCCATCCCGGGCTGGG + Exonic
1148422876 17:47563320-47563342 AACCATGACCAGGCTGGGCATGG - Intronic
1149363088 17:55914224-55914246 AGGCATGGCCAGGCTGGGCTGGG + Intergenic
1151320405 17:73349186-73349208 TGCTATGGCCATGCTGGGCCTGG + Intronic
1152068665 17:78124758-78124780 CGCCAGGCCCAGGCTGTGCAAGG + Exonic
1152074757 17:78152045-78152067 AGCCAAGCCCAGGCTGGGCACGG - Intronic
1152400510 17:80063699-80063721 CCCCATGGCCAGGCTGGTCTCGG + Intronic
1152643505 17:81458662-81458684 CGCCAAGGCCATCCTGGGGAAGG + Exonic
1152732059 17:81977390-81977412 CGCCGGGGCCAGGCTGGGCCGGG - Intronic
1153332073 18:3883702-3883724 GGCAAAGGCCAGGCTGGGCAAGG + Intronic
1154130289 18:11730961-11730983 ACCCAAGGCCATGCTAGGCAAGG - Intronic
1154367808 18:13726997-13727019 CCCCAGGGCCGTGCTGGGGAGGG + Intronic
1154442811 18:14407949-14407971 CTCAAAGGCAATGCTGGGCAGGG + Intergenic
1155492813 18:26416885-26416907 AGTGATAGCCATGCTGGGCAGGG - Intergenic
1156392148 18:36660496-36660518 AGCCAGTGCCATGTTGGGCACGG - Intronic
1156442301 18:37203670-37203692 CCTCCTGGCCATGCTGGGAAGGG - Intronic
1157563352 18:48663769-48663791 CTCTCTGGACATGCTGGGCACGG + Exonic
1160276787 18:77444508-77444530 CGCGATGGCTATACTGTGCAGGG - Intergenic
1160431139 18:78813365-78813387 AGCCATGGCCACGCTGGCCCAGG - Intergenic
1160749932 19:729031-729053 AGGCATGGACATGCTGGGCGTGG + Intronic
1160870906 19:1277423-1277445 GGCCATGGCCCCACTGGGCAGGG + Intronic
1160910516 19:1471772-1471794 GGCCTTGCCCATGCTGGGGATGG - Exonic
1161064131 19:2229255-2229277 CGCCATGTCCCTGGAGGGCACGG - Intronic
1162019787 19:7863137-7863159 GGCCAGTGCCATGCTGGGCCTGG - Intronic
1162569444 19:11462665-11462687 AATCATGTCCATGCTGGGCACGG + Intronic
1163326681 19:16608036-16608058 CACCAGGGCCCTGGTGGGCAAGG + Intronic
1164985246 19:32643662-32643684 CGTCATGGCCTTGCTGGTAAGGG - Intronic
1165349708 19:35269098-35269120 CCCCATGGACATGCTGGACCCGG + Exonic
1165744810 19:38224286-38224308 CGCCCGGGCCATGCTGGGAGTGG + Intronic
1167614507 19:50524996-50525018 CTCCATGGCAGAGCTGGGCAGGG + Intronic
1167960158 19:53098760-53098782 CCCGGTGGCCATCCTGGGCAGGG - Intronic
1167963947 19:53128568-53128590 CCCAGTGGCCATCCTGGGCAGGG - Intronic
1168713287 19:58513668-58513690 CCCCAGGGTCAGGCTGGGCAAGG - Exonic
925369642 2:3335405-3335427 CTCCATGGTCCTGCAGGGCATGG - Intronic
927145753 2:20164578-20164600 CTCCCTGGCCATGCTGAGCAGGG + Intergenic
930930431 2:56875311-56875333 AGCAGTGGCCATGCAGGGCAGGG - Intergenic
931321421 2:61177535-61177557 CGCCATGGCCAAGTGGGGCCAGG + Exonic
931440625 2:62287770-62287792 CAACATGGCAAAGCTGGGCATGG - Intergenic
933921214 2:87048718-87048740 AGGCATGGCCATGCTGTGCTGGG - Intergenic
933930420 2:87145079-87145101 AGGCATGGCCATGCTGTGCTGGG + Intergenic
934001752 2:87720867-87720889 AGGCATGGCCATGCTGTGCTGGG + Intergenic
934567114 2:95347016-95347038 TGCCATGGGCATCCAGGGCATGG + Intronic
936362710 2:111820369-111820391 AGGCATGGCCATGCTGTGCTGGG - Intronic
938199413 2:129360929-129360951 GGCCCTGGCAATGCTGGGGAGGG + Intergenic
944513753 2:200490369-200490391 AGCCACGGCCCTGGTGGGCACGG - Exonic
945201859 2:207289836-207289858 CACCATGGCTGAGCTGGGCAGGG - Intergenic
946285194 2:218697472-218697494 GGCCATGGCCAGGCTCAGCAGGG - Exonic
946358857 2:219206971-219206993 CTCCATCGCCAAGCCGGGCAGGG - Exonic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
948611093 2:239167458-239167480 GGCCAGGCCTATGCTGGGCATGG - Intronic
948826120 2:240574139-240574161 CTCCATGGCCACGATGGGGAAGG - Exonic
948838357 2:240637001-240637023 AGTCATGGGCAGGCTGGGCATGG - Intergenic
948894729 2:240922791-240922813 CTCCATGGCCTGGCAGGGCAGGG + Intronic
1169288093 20:4326280-4326302 CTCCATGGCCATTCTGGAGAAGG - Intergenic
1171498401 20:25574313-25574335 TGCCATGGCATGGCTGGGCAAGG + Intronic
1171784415 20:29449149-29449171 GGCCAGGGCCAGGCTGGGCCAGG + Intergenic
1174568353 20:51483480-51483502 CCCCATGGCCATGCAGCACATGG + Intronic
1175496370 20:59417172-59417194 CCCGCTGGACATGCTGGGCAGGG - Intergenic
1175851030 20:62093094-62093116 CCCCAGGGCTCTGCTGGGCAGGG - Intergenic
1175938697 20:62527212-62527234 GGCCGTGCACATGCTGGGCAGGG - Intergenic
1175964439 20:62653387-62653409 CGGCCTGACCATGCTGGGCCCGG + Intronic
1176022369 20:62968297-62968319 CGCCATGGCCATGCTGGGCAGGG - Exonic
1176032297 20:63018423-63018445 TGCCCTGGCCGTGCTCGGCAAGG + Intergenic
1178293192 21:31386960-31386982 CGGCATGGCCCCGCTGGGCTGGG + Intronic
1178411175 21:32364930-32364952 GGCCCTGGCCCTGCAGGGCATGG + Intronic
1180022500 21:45137392-45137414 CGCCATCGCCATGCTGGTGGTGG + Intronic
1180223849 21:46377234-46377256 CCTCCTGGCCGTGCTGGGCAGGG + Intronic
1180839903 22:18954423-18954445 GGCCAAGGCAAGGCTGGGCAGGG + Intergenic
1181032810 22:20156452-20156474 CGACTTGGCCATGCTGGGGAGGG - Intergenic
1181510511 22:23386804-23386826 CGGCTTAGCCATGCTGGGGACGG + Intergenic
1181886275 22:26024673-26024695 CGCCATGGCAATGATGGGCCCGG - Intronic
1182073865 22:27481558-27481580 CTCCCGGGCCATGCTGGGGACGG - Intergenic
1183482098 22:38070762-38070784 GCCCAGGGCCATGCTGGGGAGGG - Intronic
1184569367 22:45312024-45312046 GGCCAGGACCATGCTGGGCTAGG + Intronic
1184740845 22:46428330-46428352 CGCGATCGCCATGCTGGCCACGG - Intronic
949684533 3:6553264-6553286 TGCCAGGAACATGCTGGGCAAGG - Intergenic
950119917 3:10474915-10474937 AGCCATGGACATGCTGGGCCAGG - Intronic
950270089 3:11606994-11607016 CACCATGGCCATGCTGTGTCCGG - Intronic
950963773 3:17131815-17131837 GGACATGGCCATGCTTGGGATGG + Intergenic
950970222 3:17178921-17178943 AGGCATGGCCATGCTGGTCAGGG + Intronic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
952805225 3:37343409-37343431 CAGCCTGGCCAGGCTGGGCACGG - Intronic
954582011 3:51707950-51707972 GGCCATGGCTAGGGTGGGCAGGG + Intronic
955696123 3:61638726-61638748 AGGCATGGCAAGGCTGGGCACGG - Intronic
956164510 3:66386239-66386261 CACCATGGCTATGGTGGGCAAGG - Exonic
956673685 3:71715219-71715241 CACCATGGACATTCTGGCCAGGG - Intronic
959564705 3:107822581-107822603 ACCCAAGGCTATGCTGGGCAAGG - Intergenic
961455060 3:127019941-127019963 CACCAGGGGCAGGCTGGGCAGGG - Intronic
961536346 3:127573247-127573269 TTCCAGGGCCATGCTTGGCAAGG - Exonic
961745674 3:129062204-129062226 CGCCGTGGCCGCGCTGGGCCTGG + Exonic
962349463 3:134646111-134646133 AGAAATGGCCATGCAGGGCATGG - Intronic
968578906 4:1380609-1380631 CGCTATGGCCATGCTGGATGAGG + Intronic
968664435 4:1813400-1813422 CAGCATGGCCAGGCTGGCCAGGG - Exonic
968904430 4:3444952-3444974 CGCCGCGGCCCTGCTGGGCCTGG + Exonic
969082135 4:4627101-4627123 AGCCAGGGCCATGCTCGGCTGGG - Intergenic
973769764 4:54195601-54195623 GGCAATGGCTAGGCTGGGCATGG + Intronic
973894063 4:55395333-55395355 CGTCAAGGCCATACTGGACAAGG + Intergenic
976455820 4:85246140-85246162 CGCCATGGCCAGGCCGAGCGAGG - Intergenic
977701635 4:100029065-100029087 CACCATGGCCATGTTGTTCATGG + Intergenic
979145248 4:117239429-117239451 AGCCCTAACCATGCTGGGCAGGG + Intergenic
982600804 4:157445595-157445617 CAGCATGGGCATGCTGGGCAAGG - Intergenic
984058898 4:174966666-174966688 CTCCATGGCTCTGCTGGTCATGG + Intronic
985546350 5:511126-511148 CCCACTGGCCTTGCTGGGCAGGG + Intronic
985621582 5:958913-958935 CGCCAAGGCGTTGCTGGCCAGGG + Intergenic
985756257 5:1720384-1720406 TGCCAAGGCCATTCTGAGCATGG + Intergenic
985969779 5:3365878-3365900 GGCCATGGCCCTTCTGGGCATGG - Intergenic
990878296 5:60511257-60511279 CACCATGGCAGGGCTGGGCATGG - Intronic
994025332 5:95074944-95074966 CGACAGAGCCAAGCTGGGCATGG - Intronic
997267278 5:132502202-132502224 TGCCAGGGTCATGCAGGGCAGGG - Intergenic
997474348 5:134134001-134134023 CTCCTTGGCCATGCTGGGCCTGG - Intronic
998186122 5:139981355-139981377 CCACATGGCCATGGTGGGAAGGG + Intronic
998836779 5:146210112-146210134 GGCCATGGGCGTGCAGGGCAAGG + Intronic
1001584390 5:172823530-172823552 GGCCCTGGCCTTGCTGGACACGG + Intergenic
1001753289 5:174147664-174147686 GGCCAGACCCATGCTGGGCAGGG - Intronic
1002109751 5:176900524-176900546 AGCCCTGGCCATGCTTGTCAGGG - Intergenic
1002141725 5:177145620-177145642 TTCCATGGCCAGGCTGGGCGTGG + Intronic
1002442125 5:179269957-179269979 CTCCCTGGCCATGCTGGCCTTGG - Intronic
1004394878 6:15239055-15239077 CGCCATGTCCATGGTGGGAAAGG + Intergenic
1005528096 6:26672201-26672223 CGCCACGGACATTCTGGTCAGGG - Intergenic
1005542699 6:26829438-26829460 CGCCACGGACATTCTGGTCAGGG + Intergenic
1007094594 6:39205496-39205518 GGCCATAGCCACCCTGGGCAGGG - Intronic
1007462460 6:42028351-42028373 GGCGATGGCCATGCTGGGCGAGG + Intronic
1008096243 6:47342529-47342551 GACCATGGCCATCCTGGTCATGG + Intergenic
1008096244 6:47342531-47342553 CGCCATGACCAGGATGGCCATGG - Intergenic
1011275887 6:85631050-85631072 GGCCATGGCTTGGCTGGGCACGG + Intronic
1013303374 6:108824898-108824920 AGCAAAGGCCATGCTGGGCATGG + Intergenic
1015206241 6:130642746-130642768 CTCCATAGCCATACTTGGCATGG + Intergenic
1017189395 6:151635937-151635959 CCCCAAGGCCATGCTGCCCAGGG - Intergenic
1019179667 6:170178368-170178390 TGCCAGGGCCATGTTGGCCACGG + Intergenic
1019267172 7:124392-124414 CAGCAGGGCCATGCTGTGCAGGG + Intergenic
1019271514 7:151604-151626 CACGATGGCCATGCTCGGCGCGG - Intergenic
1019573484 7:1724970-1724992 CGCCAGGGCCATGCCCGGCATGG - Intronic
1020217263 7:6202747-6202769 AGCAATGGCCTGGCTGGGCACGG - Intronic
1024359834 7:48456010-48456032 AGCCATGGCCGTGCCCGGCAAGG - Intronic
1024821181 7:53331531-53331553 ACCTAAGGCCATGCTGGGCAAGG - Intergenic
1026915214 7:74115972-74115994 CGTGAGGGCCATGATGGGCAGGG - Intronic
1028081434 7:86582757-86582779 CACTATGGACAGGCTGGGCACGG + Intergenic
1029643011 7:101832888-101832910 CGCCATGGCCATGCAGGGAGGGG + Intronic
1029736541 7:102468665-102468687 GGCCCTGTCCCTGCTGGGCAAGG + Intronic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1032458758 7:132093902-132093924 CCCACTGGCCATGCTGGGCCTGG + Intergenic
1034412813 7:150950162-150950184 CGTCGTGGCCATCCTGGGTATGG - Exonic
1035123375 7:156588754-156588776 CGCCCAGTCCAGGCTGGGCATGG + Intergenic
1035813520 8:2513558-2513580 CACCACGGACAAGCTGGGCAGGG + Intergenic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1036710911 8:11077942-11077964 CGGGCTGGCCCTGCTGGGCAGGG + Intronic
1036730493 8:11258838-11258860 CGCAGTGGCCATCCTGGGCAAGG - Intergenic
1038210699 8:25516910-25516932 GGCCACGGCCATGCTGGGAAAGG + Intergenic
1039546291 8:38413645-38413667 CGCCATTGGCAAGCTGGGCTGGG + Exonic
1047284550 8:123476101-123476123 ATCCATAGGCATGCTGGGCATGG - Intergenic
1048161655 8:132027028-132027050 CCAGATGGCCATACTGGGCATGG - Intronic
1048814665 8:138321201-138321223 TGCCATGCCCATGCTTGCCATGG - Intronic
1049368735 8:142253432-142253454 CCCAGTGGCCATTCTGGGCAGGG + Intronic
1049417312 8:142500997-142501019 CGCCTTGGACATGGTGAGCACGG + Intronic
1049576857 8:143393591-143393613 CCCCCTGCCCATCCTGGGCAGGG + Intergenic
1049970090 9:814475-814497 TCCTAGGGCCATGCTGGGCATGG + Intergenic
1051372565 9:16370983-16371005 TGACATGGCCATCCTCGGCAGGG + Intergenic
1052819525 9:33127982-33128004 AGCCAGGGCCCTGCTGGTCAGGG - Intronic
1054463981 9:65481688-65481710 TGCCAGGGCTATGCTGAGCAGGG + Intergenic
1057189162 9:93076820-93076842 TGGCATGGCTCTGCTGGGCATGG + Intronic
1057214683 9:93221149-93221171 TGCCGTGCTCATGCTGGGCATGG + Intronic
1057499950 9:95589100-95589122 CGCACTGGACCTGCTGGGCAGGG + Intergenic
1058778817 9:108312406-108312428 CGCTATTGACATGCTGGACAGGG + Intergenic
1060266048 9:122111986-122112008 AGCCAGGGCCATGCTGGGGGAGG + Intergenic
1060727618 9:126016646-126016668 CGCCCTGGCCCTGCTAGGCCTGG + Intergenic
1061145117 9:128793105-128793127 AGCAAAGGCCATGTTGGGCAGGG + Intronic
1061912820 9:133733967-133733989 CACGTTGGCCGTGCTGGGCAGGG + Exonic
1062234853 9:135502892-135502914 CGCCAGTGCCTTGATGGGCAGGG + Intronic
1062245143 9:135562304-135562326 CGCCATGGCCATGGAGTGCCAGG - Exonic
1062373024 9:136249766-136249788 CGTGATGGCCACGCAGGGCAGGG + Intergenic
1062450579 9:136614139-136614161 GGCCTTGGCAAGGCTGGGCAAGG + Intergenic
1062522520 9:136964155-136964177 CTCCAGGGCCAGGGTGGGCACGG - Intergenic
1062682055 9:137787487-137787509 GGCCGTGGCCGAGCTGGGCACGG - Intronic
1194376296 X:93137555-93137577 CTCCATGGTTCTGCTGGGCATGG - Intergenic
1195228602 X:102823405-102823427 CCCTATGGCTTTGCTGGGCATGG + Intergenic
1197004067 X:121474609-121474631 CGCCATGGCCTTGCTGAGCTGGG + Intergenic
1198129121 X:133676349-133676371 GTGCATGGCCATGGTGGGCATGG + Intronic
1198491679 X:137147430-137147452 GGCCATGGGCAGGCTGGGAAAGG + Intergenic
1201633195 Y:16092745-16092767 CGCCATGGAGTTGCTGGACATGG - Intergenic