ID: 1176023555

View in Genome Browser
Species Human (GRCh38)
Location 20:62974652-62974674
Sequence GAGCGTCTTTTGTATTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176023555_1176023559 21 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023559 20:62974696-62974718 AGGGAGGCTGTGCTCGTGCATGG No data
1176023555_1176023557 2 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023557 20:62974677-62974699 AACTTTCAAAGAAGCTGACAGGG No data
1176023555_1176023556 1 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023556 20:62974676-62974698 CAACTTTCAAAGAAGCTGACAGG No data
1176023555_1176023561 27 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023561 20:62974702-62974724 GCTGTGCTCGTGCATGGAGTGGG No data
1176023555_1176023563 29 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023563 20:62974704-62974726 TGTGCTCGTGCATGGAGTGGGGG No data
1176023555_1176023558 5 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023558 20:62974680-62974702 TTTCAAAGAAGCTGACAGGGAGG No data
1176023555_1176023560 26 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023560 20:62974701-62974723 GGCTGTGCTCGTGCATGGAGTGG No data
1176023555_1176023562 28 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023562 20:62974703-62974725 CTGTGCTCGTGCATGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176023555 Original CRISPR GAGCGTCTTTTGTATTGCAA AGG (reversed) Intergenic
No off target data available for this crispr