ID: 1176023560

View in Genome Browser
Species Human (GRCh38)
Location 20:62974701-62974723
Sequence GGCTGTGCTCGTGCATGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176023555_1176023560 26 Left 1176023555 20:62974652-62974674 CCTTTGCAATACAAAAGACGCTC No data
Right 1176023560 20:62974701-62974723 GGCTGTGCTCGTGCATGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176023560 Original CRISPR GGCTGTGCTCGTGCATGGAG TGG Intergenic
No off target data available for this crispr