ID: 1176024069

View in Genome Browser
Species Human (GRCh38)
Location 20:62977022-62977044
Sequence CCTCGCTGCTTGGTAGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176024069_1176024073 3 Left 1176024069 20:62977022-62977044 CCAGGGTCTACCAAGCAGCGAGG No data
Right 1176024073 20:62977048-62977070 CCCGAGAGCATACGACAGCCTGG No data
1176024069_1176024077 24 Left 1176024069 20:62977022-62977044 CCAGGGTCTACCAAGCAGCGAGG No data
Right 1176024077 20:62977069-62977091 GGCGCTGCCCTGACCTCCTTGGG No data
1176024069_1176024078 25 Left 1176024069 20:62977022-62977044 CCAGGGTCTACCAAGCAGCGAGG No data
Right 1176024078 20:62977070-62977092 GCGCTGCCCTGACCTCCTTGGGG No data
1176024069_1176024076 23 Left 1176024069 20:62977022-62977044 CCAGGGTCTACCAAGCAGCGAGG No data
Right 1176024076 20:62977068-62977090 TGGCGCTGCCCTGACCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176024069 Original CRISPR CCTCGCTGCTTGGTAGACCC TGG (reversed) Intergenic
No off target data available for this crispr