ID: 1176026963

View in Genome Browser
Species Human (GRCh38)
Location 20:62990704-62990726
Sequence GGTACTAAGTGCCCACAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176026963_1176026975 27 Left 1176026963 20:62990704-62990726 CCGGCTTGTGGGCACTTAGTACC No data
Right 1176026975 20:62990754-62990776 ACAACGGCGGTTCCTGAGCTGGG No data
1176026963_1176026969 11 Left 1176026963 20:62990704-62990726 CCGGCTTGTGGGCACTTAGTACC No data
Right 1176026969 20:62990738-62990760 AACCTCCAACAACTCCACAACGG No data
1176026963_1176026974 26 Left 1176026963 20:62990704-62990726 CCGGCTTGTGGGCACTTAGTACC No data
Right 1176026974 20:62990753-62990775 CACAACGGCGGTTCCTGAGCTGG No data
1176026963_1176026971 14 Left 1176026963 20:62990704-62990726 CCGGCTTGTGGGCACTTAGTACC No data
Right 1176026971 20:62990741-62990763 CTCCAACAACTCCACAACGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176026963 Original CRISPR GGTACTAAGTGCCCACAAGC CGG (reversed) Intergenic
No off target data available for this crispr