ID: 1176028850

View in Genome Browser
Species Human (GRCh38)
Location 20:63000699-63000721
Sequence TTTATGAAACAGACTTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176028846_1176028850 19 Left 1176028846 20:63000657-63000679 CCCTTTGGGATTAAATTTGCAAA No data
Right 1176028850 20:63000699-63000721 TTTATGAAACAGACTTTGGTTGG No data
1176028847_1176028850 18 Left 1176028847 20:63000658-63000680 CCTTTGGGATTAAATTTGCAAAT No data
Right 1176028850 20:63000699-63000721 TTTATGAAACAGACTTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176028850 Original CRISPR TTTATGAAACAGACTTTGGT TGG Intergenic
No off target data available for this crispr