ID: 1176029506

View in Genome Browser
Species Human (GRCh38)
Location 20:63005221-63005243
Sequence TGCGGGCCCTCTGCCTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029506_1176029514 7 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029506_1176029521 23 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029506_1176029523 27 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029506_1176029517 17 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029506_1176029524 30 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029506 Original CRISPR TGCGGGCCCTCTGCCTCGGG GGG (reversed) Intergenic