ID: 1176029510

View in Genome Browser
Species Human (GRCh38)
Location 20:63005225-63005247
Sequence GCTTTGCGGGCCCTCTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029510_1176029524 26 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029510_1176029521 19 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029510_1176029525 29 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029525 20:63005277-63005299 TCCCAGGCAGCGGATGGCGGCGG No data
1176029510_1176029514 3 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029510_1176029527 30 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029527 20:63005278-63005300 CCCAGGCAGCGGATGGCGGCGGG No data
1176029510_1176029517 13 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029510_1176029523 23 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029510 Original CRISPR GCTTTGCGGGCCCTCTGCCT CGG (reversed) Intergenic