ID: 1176029513

View in Genome Browser
Species Human (GRCh38)
Location 20:63005239-63005261
Sequence GTTGGATGGAGACCGCTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029513_1176029535 25 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029535 20:63005287-63005309 CGGATGGCGGCGGGGGGGGGAGG No data
1176029513_1176029527 16 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029527 20:63005278-63005300 CCCAGGCAGCGGATGGCGGCGGG No data
1176029513_1176029530 18 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029530 20:63005280-63005302 CAGGCAGCGGATGGCGGCGGGGG No data
1176029513_1176029521 5 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029513_1176029517 -1 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029513_1176029532 20 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029532 20:63005282-63005304 GGCAGCGGATGGCGGCGGGGGGG No data
1176029513_1176029531 19 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029531 20:63005281-63005303 AGGCAGCGGATGGCGGCGGGGGG No data
1176029513_1176029534 22 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029534 20:63005284-63005306 CAGCGGATGGCGGCGGGGGGGGG No data
1176029513_1176029536 30 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029536 20:63005292-63005314 GGCGGCGGGGGGGGGAGGCCAGG No data
1176029513_1176029524 12 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029513_1176029533 21 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029533 20:63005283-63005305 GCAGCGGATGGCGGCGGGGGGGG No data
1176029513_1176029525 15 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029525 20:63005277-63005299 TCCCAGGCAGCGGATGGCGGCGG No data
1176029513_1176029523 9 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029513_1176029529 17 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029529 20:63005279-63005301 CCAGGCAGCGGATGGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029513 Original CRISPR GTTGGATGGAGACCGCTTTG CGG (reversed) Intergenic