ID: 1176029514

View in Genome Browser
Species Human (GRCh38)
Location 20:63005251-63005273
Sequence CTCCATCCAACTCCACCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029508_1176029514 5 Left 1176029508 20:63005223-63005245 CCCCGAGGCAGAGGGCCCGCAAA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029512_1176029514 -10 Left 1176029512 20:63005238-63005260 CCCGCAAAGCGGTCTCCATCCAA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029510_1176029514 3 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029507_1176029514 6 Left 1176029507 20:63005222-63005244 CCCCCGAGGCAGAGGGCCCGCAA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029503_1176029514 15 Left 1176029503 20:63005213-63005235 CCACGCAGCCCCCCGAGGCAGAG No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029509_1176029514 4 Left 1176029509 20:63005224-63005246 CCCGAGGCAGAGGGCCCGCAAAG No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029502_1176029514 18 Left 1176029502 20:63005210-63005232 CCTCCACGCAGCCCCCCGAGGCA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029499_1176029514 22 Left 1176029499 20:63005206-63005228 CCCTCCTCCACGCAGCCCCCCGA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029500_1176029514 21 Left 1176029500 20:63005207-63005229 CCTCCTCCACGCAGCCCCCCGAG No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data
1176029506_1176029514 7 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029514 20:63005251-63005273 CTCCATCCAACTCCACCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029514 Original CRISPR CTCCATCCAACTCCACCCCG CGG Intergenic