ID: 1176029516

View in Genome Browser
Species Human (GRCh38)
Location 20:63005257-63005279
Sequence GGACGTCCGCGGGGTGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029516_1176029534 4 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029534 20:63005284-63005306 CAGCGGATGGCGGCGGGGGGGGG No data
1176029516_1176029541 25 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029541 20:63005305-63005327 GGAGGCCAGGGGACATTTAGGGG No data
1176029516_1176029523 -9 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029516_1176029536 12 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029536 20:63005292-63005314 GGCGGCGGGGGGGGGAGGCCAGG No data
1176029516_1176029535 7 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029535 20:63005287-63005309 CGGATGGCGGCGGGGGGGGGAGG No data
1176029516_1176029533 3 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029533 20:63005283-63005305 GCAGCGGATGGCGGCGGGGGGGG No data
1176029516_1176029537 13 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029537 20:63005293-63005315 GCGGCGGGGGGGGGAGGCCAGGG No data
1176029516_1176029524 -6 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029516_1176029538 14 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029538 20:63005294-63005316 CGGCGGGGGGGGGAGGCCAGGGG No data
1176029516_1176029527 -2 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029527 20:63005278-63005300 CCCAGGCAGCGGATGGCGGCGGG No data
1176029516_1176029525 -3 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029525 20:63005277-63005299 TCCCAGGCAGCGGATGGCGGCGG No data
1176029516_1176029539 23 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029539 20:63005303-63005325 GGGGAGGCCAGGGGACATTTAGG No data
1176029516_1176029531 1 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029531 20:63005281-63005303 AGGCAGCGGATGGCGGCGGGGGG No data
1176029516_1176029530 0 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029530 20:63005280-63005302 CAGGCAGCGGATGGCGGCGGGGG No data
1176029516_1176029532 2 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029532 20:63005282-63005304 GGCAGCGGATGGCGGCGGGGGGG No data
1176029516_1176029540 24 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029540 20:63005304-63005326 GGGAGGCCAGGGGACATTTAGGG No data
1176029516_1176029529 -1 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029529 20:63005279-63005301 CCAGGCAGCGGATGGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029516 Original CRISPR GGACGTCCGCGGGGTGGAGT TGG (reversed) Intergenic