ID: 1176029517

View in Genome Browser
Species Human (GRCh38)
Location 20:63005261-63005283
Sequence CTCCACCCCGCGGACGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029509_1176029517 14 Left 1176029509 20:63005224-63005246 CCCGAGGCAGAGGGCCCGCAAAG No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029508_1176029517 15 Left 1176029508 20:63005223-63005245 CCCCGAGGCAGAGGGCCCGCAAA No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029512_1176029517 0 Left 1176029512 20:63005238-63005260 CCCGCAAAGCGGTCTCCATCCAA No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029510_1176029517 13 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029507_1176029517 16 Left 1176029507 20:63005222-63005244 CCCCCGAGGCAGAGGGCCCGCAA No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029506_1176029517 17 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029503_1176029517 25 Left 1176029503 20:63005213-63005235 CCACGCAGCCCCCCGAGGCAGAG No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029513_1176029517 -1 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data
1176029502_1176029517 28 Left 1176029502 20:63005210-63005232 CCTCCACGCAGCCCCCCGAGGCA No data
Right 1176029517 20:63005261-63005283 CTCCACCCCGCGGACGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029517 Original CRISPR CTCCACCCCGCGGACGTCCC AGG Intergenic