ID: 1176029521

View in Genome Browser
Species Human (GRCh38)
Location 20:63005267-63005289
Sequence CCCGCGGACGTCCCAGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029515_1176029521 -9 Left 1176029515 20:63005253-63005275 CCATCCAACTCCACCCCGCGGAC No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029506_1176029521 23 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029509_1176029521 20 Left 1176029509 20:63005224-63005246 CCCGAGGCAGAGGGCCCGCAAAG No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029507_1176029521 22 Left 1176029507 20:63005222-63005244 CCCCCGAGGCAGAGGGCCCGCAA No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029510_1176029521 19 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029508_1176029521 21 Left 1176029508 20:63005223-63005245 CCCCGAGGCAGAGGGCCCGCAAA No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029512_1176029521 6 Left 1176029512 20:63005238-63005260 CCCGCAAAGCGGTCTCCATCCAA No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data
1176029513_1176029521 5 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029521 20:63005267-63005289 CCCGCGGACGTCCCAGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029521 Original CRISPR CCCGCGGACGTCCCAGGCAG CGG Intergenic