ID: 1176029523

View in Genome Browser
Species Human (GRCh38)
Location 20:63005271-63005293
Sequence CGGACGTCCCAGGCAGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029507_1176029523 26 Left 1176029507 20:63005222-63005244 CCCCCGAGGCAGAGGGCCCGCAA No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029512_1176029523 10 Left 1176029512 20:63005238-63005260 CCCGCAAAGCGGTCTCCATCCAA No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029506_1176029523 27 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029508_1176029523 25 Left 1176029508 20:63005223-63005245 CCCCGAGGCAGAGGGCCCGCAAA No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029515_1176029523 -5 Left 1176029515 20:63005253-63005275 CCATCCAACTCCACCCCGCGGAC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029513_1176029523 9 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029516_1176029523 -9 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029509_1176029523 24 Left 1176029509 20:63005224-63005246 CCCGAGGCAGAGGGCCCGCAAAG No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data
1176029510_1176029523 23 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC No data
Right 1176029523 20:63005271-63005293 CGGACGTCCCAGGCAGCGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029523 Original CRISPR CGGACGTCCCAGGCAGCGGA TGG Intergenic