ID: 1176029524

View in Genome Browser
Species Human (GRCh38)
Location 20:63005274-63005296
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029515_1176029524 -2 Left 1176029515 20:63005253-63005275 CCATCCAACTCCACCCCGCGGAC No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029513_1176029524 12 Left 1176029513 20:63005239-63005261 CCGCAAAGCGGTCTCCATCCAAC No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029507_1176029524 29 Left 1176029507 20:63005222-63005244 CCCCCGAGGCAGAGGGCCCGCAA No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029516_1176029524 -6 Left 1176029516 20:63005257-63005279 CCAACTCCACCCCGCGGACGTCC No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029510_1176029524 26 Left 1176029510 20:63005225-63005247 CCGAGGCAGAGGGCCCGCAAAGC 0: 1
1: 0
2: 0
3: 15
4: 156
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029506_1176029524 30 Left 1176029506 20:63005221-63005243 CCCCCCGAGGCAGAGGGCCCGCA No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029508_1176029524 28 Left 1176029508 20:63005223-63005245 CCCCGAGGCAGAGGGCCCGCAAA No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029509_1176029524 27 Left 1176029509 20:63005224-63005246 CCCGAGGCAGAGGGCCCGCAAAG No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data
1176029512_1176029524 13 Left 1176029512 20:63005238-63005260 CCCGCAAAGCGGTCTCCATCCAA No data
Right 1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029524 Original CRISPR ACGTCCCAGGCAGCGGATGG CGG Intergenic