ID: 1176029798

View in Genome Browser
Species Human (GRCh38)
Location 20:63006476-63006498
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1664
Summary {0: 2, 1: 11, 2: 68, 3: 358, 4: 1225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029798 Original CRISPR GAGCAGCGGCGGCGGCGGCG CGG (reversed) Exonic
900091953 1:924508-924530 CAGCGGCGGCAGCGGCAGCGCGG - Intergenic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900237572 1:1600057-1600079 CAGCGGGGACGGCGGCGGCGCGG - Exonic
900243277 1:1626772-1626794 GGGCAGCGGCGCTAGCGGCGGGG - Intronic
900249293 1:1658913-1658935 CGGCAGCGGCGGCGGCGTAGGGG - Exonic
900314613 1:2050598-2050620 GCGCAGCGCTGACGGCGGCGGGG + Exonic
900329577 1:2127396-2127418 GGGCAGGGGCGGCGGTGGGGGGG - Intronic
900349594 1:2228303-2228325 GAGGAGCGGGGGCGCGGGCGCGG - Intergenic
900349671 1:2228502-2228524 GGGCGGCGGCGGGCGCGGCGCGG + Intergenic
900385663 1:2409488-2409510 GAGCAGGGGCGGCAGCGAGGGGG - Intronic
901056026 1:6448972-6448994 CAGGGGCGGCGGCGGCGGTGGGG - Exonic
901086042 1:6613255-6613277 GAGTAGGGGCGGCAGGGGCGGGG - Intronic
901279933 1:8026162-8026184 GAGGAGCGGCGGCTGCCCCGCGG + Exonic
901433877 1:9234716-9234738 GCGCGGCGGGGGCGGGGGCGGGG - Intergenic
901433992 1:9235076-9235098 GGGCGGCGGCGGGGCCGGCGGGG - Intronic
901443648 1:9293622-9293644 GAGAAGCCGCGGCGGCTCCGGGG - Intronic
901641334 1:10694583-10694605 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
901673039 1:10867101-10867123 GAGCGGCTGCGGGGGCGGCGGGG - Intergenic
901853239 1:12029247-12029269 GAGCAGTGGCAGCGGCGTGGAGG + Exonic
902286200 1:15410066-15410088 GGGCAGCGGCGGCGGCGGCGGGG + Exonic
902377173 1:16035275-16035297 CAGCATCGGCGGCGGCTGCCCGG - Intergenic
902382351 1:16058534-16058556 CAGCATCGGCGGCGGCTGCCCGG - Exonic
902823137 1:18955807-18955829 GCGCACGGGCGGCGGCGGCGTGG - Exonic
902823236 1:18956230-18956252 CGGGGGCGGCGGCGGCGGCGGGG - Exonic
902950984 1:19882642-19882664 TGGCGGCGGCGGCGGCTGCGAGG + Exonic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903263367 1:22142948-22142970 GGGCAGCGGCTGCGGCCGCGGGG + Exonic
903324831 1:22563729-22563751 GGTGAGCGGCGGCGGCGGGGCGG + Exonic
903372616 1:22846693-22846715 GAGCAGCGTGGGCGGAGGGGTGG - Intronic
903438310 1:23368894-23368916 CAACAGCGCCTGCGGCGGCGCGG + Intronic
903446156 1:23424173-23424195 GGGGAGCGGCGGCGATGGCGGGG - Intronic
903724550 1:25431053-25431075 GAGAGACGGCGGCGGCGGCGCGG + Exonic
903742499 1:25566530-25566552 GAGCAGCGGGGGTGGGGGTGGGG - Intronic
903750213 1:25616799-25616821 CCCGAGCGGCGGCGGCGGCGGGG + Intergenic
903822117 1:26111183-26111205 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
903832902 1:26185121-26185143 AACCAGCGGCGGCGCCAGCGCGG - Exonic
903907539 1:26696958-26696980 GAGCGGCGGCGGCGGGGGCCTGG + Exonic
903938637 1:26913672-26913694 GACCAGCGGCGGCTGCTGCAGGG - Exonic
903950675 1:26994303-26994325 CGGCCGCGGCGGCCGCGGCGCGG - Exonic
904215398 1:28914774-28914796 GCGAGGCGGCGGCGGCGGCGCGG + Intronic
904253121 1:29238368-29238390 GAGCAGCCCCGCCGGTGGCGAGG - Intronic
904620454 1:31772032-31772054 CCGTGGCGGCGGCGGCGGCGCGG + Intergenic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
904822955 1:33256831-33256853 CGGCGGCGGCGGCGGCAGCGGGG + Intronic
904940765 1:34164061-34164083 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
905137076 1:35808176-35808198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905137124 1:35808343-35808365 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
905212775 1:36385857-36385879 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
905300739 1:36984897-36984919 GGGCAGCGGAGGGGGTGGCGGGG + Intronic
905369204 1:37474401-37474423 GCGCAGCGGCCGCGGGGGCGGGG + Intergenic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905414381 1:37794388-37794410 GCGGGGCGGCGGCGGCGGCGGGG - Exonic
905449163 1:38046227-38046249 GGGGGGCGGCGGCGGCGGCCTGG - Exonic
905449325 1:38046762-38046784 GCGGAGCGGCGGCGGCGGCGCGG - Exonic
905580768 1:39081597-39081619 GCGCAGCGGCGGCTGGGGAGCGG + Intronic
905639148 1:39576587-39576609 GCGCTGCGGCGGCGGGCGCGGGG + Intronic
905947767 1:41918106-41918128 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
906140595 1:43531539-43531561 GTGCGGCGGGGGCGGGGGCGCGG - Intronic
906525243 1:46489841-46489863 TGGCAGCGGAGGCGGCGGCGCGG + Intergenic
906640512 1:47438225-47438247 GGGCGGCGGCAGCGGCGGGGGGG + Exonic
907051051 1:51330275-51330297 TGGCAGCGGCGGCGGCTGCCAGG + Intronic
907278088 1:53327951-53327973 GAGACGCGGCGGCGGCGGCGCGG - Exonic
907278105 1:53328015-53328037 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
907429960 1:54406034-54406056 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
908132170 1:61083756-61083778 TGGTGGCGGCGGCGGCGGCGGGG - Intronic
908527584 1:65002688-65002710 GGCCGGCGGCGGCGGAGGCGGGG + Intergenic
908780300 1:67684999-67685021 GAGCCGAGGGGGCGGGGGCGGGG - Intergenic
908796223 1:67833362-67833384 GAGTCCCGGCGGCGACGGCGGGG - Exonic
910449080 1:87328810-87328832 GAGGAGCGCGGGCGGGGGCGGGG + Exonic
910758983 1:90717495-90717517 GTGGCGCGGCGGTGGCGGCGCGG + Intergenic
910787999 1:91021664-91021686 GAGCGGCGGCCGCCGCCGCGGGG - Intronic
910936497 1:92486967-92486989 GGGCAGCGCCGGCGGCTGCTAGG + Intergenic
911449586 1:98046170-98046192 TAGCAGCGGCAGCGGCAGCTTGG - Intergenic
912381299 1:109249606-109249628 CAGCAGCCGCGGCGGGGACGCGG + Intergenic
912481428 1:109984784-109984806 GTACAGCGGAGGTGGCGGCGCGG + Exonic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912716966 1:111989874-111989896 GCGCGGCGCCGGCAGCGGCGGGG - Intergenic
912993490 1:114511122-114511144 GGGCGGCGGCGGCGGCGACGCGG - Exonic
913109093 1:115641971-115641993 GTGCAGCGGCGGCGGCGGCGGGG + Exonic
913703471 1:121396583-121396605 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
913938987 1:125085788-125085810 GAAAAGCCGCGGCGGCGGGGGGG + Intergenic
913939232 1:125086688-125086710 AAGCCGCGGCGGCGGCAGGGGGG + Intergenic
913959459 1:143327601-143327623 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
913979476 1:143497120-143497142 AAGCCGCGGCGGCGGGGGGGCGG - Intergenic
913979847 1:143498414-143498436 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
914044327 1:144078004-144078026 AAGCCGCGGCGGCGGGGGGGGGG - Intergenic
914053819 1:144153174-144153196 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
914074196 1:144323898-144323920 AAGCAGCGGCGGTGGCGGAGGGG - Intergenic
914104980 1:144642548-144642570 AAGCAGCGGCGGTGGCGGAGGGG + Intergenic
914125327 1:144813191-144813213 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
914133784 1:144882683-144882705 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
914255322 1:145957760-145957782 CAGCGGCGGCGGGGGCGGTGCGG + Exonic
914845630 1:151282302-151282324 AAGTAGCGGCGGCCGCGGGGAGG + Exonic
914919596 1:151838408-151838430 GAGCGGCGGCGTGGGCGGCCCGG + Exonic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915934782 1:160084067-160084089 GAGGAGCCGCCGCGGCGCCGCGG + Exonic
916174156 1:162023830-162023852 GGGAAGAGGCGGTGGCGGCGCGG + Exonic
916651668 1:166839617-166839639 GGGCGGGGGCGGCGGCGGCGCGG + Intronic
916824451 1:168430515-168430537 GAGCAGCGTGGGCGGCCGGGAGG + Intergenic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
916890259 1:169106618-169106640 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
917962337 1:180154930-180154952 CAGCAGCGACGGCGGCGGCCCGG - Exonic
918550297 1:185734407-185734429 GGAGAGCAGCGGCGGCGGCGAGG + Intergenic
919640244 1:200039319-200039341 GGGCAGCGGAGGCGACCGCGGGG - Intronic
919712133 1:200739107-200739129 CGGCAGCGGCGACGGCGGCAGGG + Intergenic
919847015 1:201648713-201648735 GAGCAGCGGCGGCGGCGACGAGG + Exonic
919847040 1:201648815-201648837 GCCCGGCGGCGGCGGCGGCATGG + Exonic
919949434 1:202348912-202348934 GAGCAGCTTCGGCGCTGGCGGGG + Exonic
920219300 1:204384784-204384806 GACAAGCGGCGGCGGCGTCCTGG + Intergenic
920528483 1:206685276-206685298 GGGCTGCGGCGGCGGGGCCGGGG - Exonic
920556635 1:206909357-206909379 GGATCGCGGCGGCGGCGGCGCGG + Intronic
921039535 1:211416660-211416682 AGGCAGCAGCGGCGGCGCCGGGG + Intergenic
921217736 1:212951476-212951498 CGGCAGCGGCGGCGGCGGCGGGG - Exonic
922416484 1:225427620-225427642 GTGGAGCGGCGGCGGCAGGGAGG - Intronic
922648637 1:227318191-227318213 CAGCAGCTGCGGCGGCGGCGCGG + Exonic
922937311 1:229432493-229432515 TAGCGGCGGGGGCGGGGGCGGGG + Intronic
922950972 1:229558427-229558449 GAGGAGCGGCTGCCGGGGCGGGG - Exonic
922958619 1:229626014-229626036 GAGCGGCGGCGGGGGCGGCGGGG - Exonic
923372332 1:233327322-233327344 GAGCACCTGCGGCGGGGGCGGGG + Intergenic
923372661 1:233328345-233328367 GGGCCGCGAGGGCGGCGGCGCGG - Exonic
923400783 1:233614081-233614103 GGGCGGGGGCGGGGGCGGCGGGG + Exonic
923592218 1:235328781-235328803 GAGCGGCAGTGGCGGCGGCTGGG + Intronic
923744308 1:236686417-236686439 GGGCGGTGGCGGCGGGGGCGTGG + Intergenic
924052425 1:240092265-240092287 AGGGGGCGGCGGCGGCGGCGGGG + Exonic
924289725 1:242524715-242524737 CCGGGGCGGCGGCGGCGGCGGGG + Intergenic
924415183 1:243850332-243850354 GAGGAGAGAGGGCGGCGGCGGGG + Intronic
924436683 1:244048905-244048927 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
924754779 1:246931477-246931499 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
924816701 1:247448215-247448237 CGGCGGCGGCGACGGCGGCGAGG + Intronic
1062759937 10:10733-10755 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062759944 10:10762-10784 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1062982534 10:1737212-1737234 CAGCGGCGGCGGCGGCTGCCGGG - Exonic
1063418129 10:5889941-5889963 GAGCAGCGGCGGTCGAGGGGCGG - Intergenic
1063418239 10:5890304-5890326 GCCCGGCGGCGGCGGCAGCGGGG + Intronic
1063443070 10:6089144-6089166 GAGCCGCGCCGGCGGCAGAGCGG - Intronic
1063652217 10:7949015-7949037 CAGCAGCGGCGGCAGCAGCCGGG - Intronic
1064060085 10:12129797-12129819 GAGTAGCGGCGGCTGGAGCGGGG + Intronic
1064086283 10:12349028-12349050 GACGGGCGGCGGCGGCGGCTGGG - Intergenic
1064179184 10:13100175-13100197 GGGCGGCGGCGGTGGCGGAGGGG - Exonic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064209080 10:13348113-13348135 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1064230824 10:13528595-13528617 CGGCAGCGGCAGCGGCGGCGCGG + Intronic
1064230925 10:13528889-13528911 CGGCGGCGGCGGCGGAGGCGGGG + Intronic
1064230986 10:13529053-13529075 GAGGAGGGGCGCCGGCGGAGGGG + Intergenic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064274196 10:13891771-13891793 CCGCGGCGGGGGCGGCGGCGGGG - Intronic
1064619587 10:17201637-17201659 GGGCTGCGGCGGCTGAGGCGCGG - Exonic
1064859772 10:19815550-19815572 AAGCCGCGGCGGCAGCGGCGGGG + Intergenic
1064981954 10:21174162-21174184 GCGCGGCGGCGGCGGCGAGGCGG - Intronic
1065024380 10:21526594-21526616 GAGGCGCGGCGGGGGCGTCGAGG - Intergenic
1065101595 10:22336544-22336566 GGGAAGCGGCTGCCGCGGCGCGG - Intergenic
1065188870 10:23192958-23192980 GAGCGGCGGCTGCGGCGGCGCGG + Exonic
1065390187 10:25175067-25175089 GAGCGGCGGTGGCGGCAGCCGGG + Exonic
1065520569 10:26567283-26567305 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1065712750 10:28533211-28533233 CGGCAGCAGCGGCGGCGGCGGGG + Intronic
1065968178 10:30785319-30785341 GAGCAGCTGCGGAGGCCGGGCGG - Intergenic
1066022736 10:31319444-31319466 CGGCAGCGGCGGCAGCGGAGGGG - Intronic
1066022864 10:31319892-31319914 GGGCTGCGGCGGCGGCGGGACGG + Intronic
1066080710 10:31928530-31928552 CGGCGGCGGCGGCGGCGCCGCGG - Intronic
1066094075 10:32056206-32056228 CGGCAGCGGCGGCGGCACCGGGG + Exonic
1066221240 10:33336935-33336957 GAGCGGCGGCCGGGGCGGCCTGG + Intergenic
1066429338 10:35336877-35336899 CAGCAGCGGCGGCGGCGGCGGGG - Exonic
1066464513 10:35640823-35640845 CGGCAGGGGCGGTGGCGGCGGGG - Exonic
1066464801 10:35641984-35642006 CGGCGGCGGCGGCGGCGGCTTGG - Exonic
1066963970 10:42243674-42243696 TGGCAGCGGCGGCGGGGGGGGGG - Intergenic
1067972715 10:50991307-50991329 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1068204177 10:53827434-53827456 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1068538663 10:58268017-58268039 TAGCGGCGGCAGCGGCGGTGCGG - Intergenic
1068690161 10:59906310-59906332 GGGCGGCGGCGGTGGCGGCGGGG - Exonic
1069386174 10:67884927-67884949 GTGCGGCGGCGGCGGCGCTGTGG + Exonic
1069424686 10:68279045-68279067 CAGCAGCGGCGGCGGGGGAGGGG + Intergenic
1069544542 10:69319017-69319039 GACCAGCGGCGGCGCGGGCGGGG - Intronic
1070328333 10:75401880-75401902 CAGCGGCGGCGGCGGCGGCGCGG - Exonic
1070329167 10:75405612-75405634 GAGCAGCGGCGAGGGCCGCGCGG - Intergenic
1070398909 10:76035832-76035854 GAGTCGGGGCGGGGGCGGCGGGG - Intronic
1070609871 10:77926123-77926145 GTGGAGCGGCGGCCCCGGCGAGG + Intronic
1070708201 10:78656960-78656982 TATCAGCGGAGGCGGCGGAGGGG + Intergenic
1070768350 10:79069023-79069045 GAGCGGCGGCGGCGGGCGCCGGG + Exonic
1070800836 10:79243560-79243582 CCCCGGCGGCGGCGGCGGCGCGG - Intronic
1070877389 10:79826386-79826408 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1070954301 10:80454342-80454364 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1071643883 10:87342427-87342449 GGGCGGAGGCGGCGGCGGCCGGG + Intergenic
1071966592 10:90858108-90858130 GGCCGGAGGCGGCGGCGGCGGGG - Intergenic
1072069778 10:91905297-91905319 GAGAAGTGGGGGCGGCGGGGGGG - Intergenic
1072591613 10:96832700-96832722 GAGCAGGGGCGGGAGCGGGGAGG - Intronic
1072719499 10:97771929-97771951 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1072745249 10:97934970-97934992 GGGGAGCGGCGGGCGCGGCGGGG + Intronic
1073058285 10:100715770-100715792 GACAGGCGGCGGCGGCGGTGAGG + Intergenic
1073099603 10:100999789-100999811 GCGCCGCGGAGGCGGAGGCGGGG + Exonic
1073101059 10:101006902-101006924 CTGCAGCGGGAGCGGCGGCGGGG + Exonic
1073110916 10:101062591-101062613 GGGCCGCGGCGGCGGCAGCATGG - Exonic
1073196435 10:101695142-101695164 GGGCGGCGGCGGTGGCGGCTCGG - Exonic
1074503355 10:114045005-114045027 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
1074618534 10:115093645-115093667 GAGGAGAAGCGGCGGCGGAGAGG + Exonic
1074843284 10:117375437-117375459 GTGTGGCGGCGGCGGCAGCGGGG + Exonic
1075206990 10:120456925-120456947 GGGAGGCGGCGGCGGCGGTGGGG + Intergenic
1075334490 10:121598458-121598480 CGGGGGCGGCGGCGGCGGCGCGG - Intronic
1075430295 10:122374763-122374785 GAGCCGGGGCCGCGGCGGCGCGG + Exonic
1075645468 10:124093343-124093365 AGGCAGCGCCGGCGGCGGCCGGG - Intronic
1075697482 10:124447614-124447636 GGGCGGCGGCGGCGGCGGCTCGG - Exonic
1075748425 10:124743973-124743995 GGGCGGCGGCGGCGGTGGCCGGG - Intronic
1076035643 10:127196607-127196629 GAGGTGGGGCGGGGGCGGCGCGG + Intronic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076554277 10:131311789-131311811 GTCCGGGGGCGGCGGCGGCGCGG - Intergenic
1076683419 10:132186587-132186609 GGGCAGCGGGGGCGCGGGCGGGG + Intergenic
1076722093 10:132397176-132397198 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076765491 10:132630791-132630813 GGGAGGCGGCGGGGGCGGCGGGG + Intronic
1076792824 10:132785985-132786007 GGGCAGGGGCGGCGGCGGCGGGG - Exonic
1076878676 10:133229842-133229864 GAGCCCGGGCGGGGGCGGCGGGG + Intergenic
1076878682 10:133229848-133229870 GGGCGGGGGCGGCGGGGGCGGGG + Intergenic
1076917792 10:133433115-133433137 GTGCAGCGTGGGCGGCTGCGGGG + Intergenic
1076937786 10:133577190-133577212 GTGCAGCGTGGGCGGCTGCGGGG + Intergenic
1077021868 11:420557-420579 GAGCAGCGGCGCCAGCGGGAAGG + Exonic
1077053101 11:576499-576521 CGGCAGAGGCGGCGGCGGCCGGG + Exonic
1077213338 11:1383434-1383456 CAGCAGCGGAGGCCGCGGCCGGG + Intergenic
1077253786 11:1571876-1571898 GAGCGGAGGCGCCGGCGGGGCGG - Intronic
1077386200 11:2270638-2270660 GAAAGGCGACGGCGGCGGCGCGG - Exonic
1077459239 11:2700475-2700497 CTGCAGCGGCGCCGGCGGAGGGG - Intronic
1077514213 11:2992071-2992093 AGGCAGCGGCGGCCGCGGCGGGG - Intronic
1077898787 11:6473908-6473930 GTCCGGCGGCGGCGCCGGCGCGG - Intronic
1077916069 11:6612165-6612187 GAGCTGCAGCGGCTCCGGCGCGG - Exonic
1077922968 11:6655473-6655495 CGGCAGCGGCGGCGGAGCCGGGG - Intronic
1077923119 11:6655917-6655939 GGGAAGGGGGGGCGGCGGCGCGG - Intergenic
1078190834 11:9091567-9091589 GGGCGGTGGCGGCGGCGGCGCGG + Exonic
1078210289 11:9265045-9265067 GAGTGGCGGCGGCGGCGGAGGGG - Exonic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1078210384 11:9265292-9265314 TAGCTGCAGCGGCGGCGGCGCGG - Exonic
1078474926 11:11622005-11622027 CGGCAGCGGCAGCGGCGGCGGGG + Exonic
1078514272 11:12009143-12009165 GAGGGGCGGCGGCGGGGGAGGGG - Intronic
1079076726 11:17389151-17389173 GTGCAGCGGCGGCGGCGGGCGGG - Intronic
1079172092 11:18106006-18106028 GCGACCCGGCGGCGGCGGCGAGG + Exonic
1079459766 11:20669497-20669519 CTGGCGCGGCGGCGGCGGCGTGG - Intergenic
1079689404 11:23403534-23403556 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1080503768 11:32893157-32893179 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1080503805 11:32893254-32893276 TGGCGGCGGCGGCGGCGGCTCGG - Exonic
1080551537 11:33376815-33376837 CAGCAGCGTCGGTGGCCGCGGGG - Intergenic
1081575436 11:44316274-44316296 GGGCAGGGGCTGCGGCGGCTGGG - Intergenic
1081773844 11:45665031-45665053 GCGGAGGGGTGGCGGCGGCGAGG - Intronic
1082029506 11:47594264-47594286 GCGCTGCGGCAGGGGCGGCGGGG + Exonic
1082787507 11:57324889-57324911 TAGCAGCGGCGGCGGCGGCGGGG - Intronic
1082807296 11:57459290-57459312 GAGCCGCGGCGCGGGCAGCGGGG + Intergenic
1082814584 11:57499671-57499693 GAGCAGCGGCCCAGGGGGCGGGG + Intronic
1082835828 11:57649541-57649563 GAGGAGCGGAGGCAGCGGGGAGG + Exonic
1083171096 11:60924507-60924529 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1083304810 11:61756675-61756697 GAACAGAGGCGGCGGGGGTGGGG + Intronic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083428465 11:62601621-62601643 TAGCTGCGGCGGCGACAGCGCGG - Exonic
1083448461 11:62726818-62726840 GGGCTCCGGCGGCGGCTGCGCGG + Exonic
1083623651 11:64060936-64060958 CCGCGGCGGCGGCGGCGGCGGGG + Intronic
1083656990 11:64234580-64234602 CAGCGGCGGCGGGGACGGCGGGG - Exonic
1083684778 11:64369626-64369648 GAGCTGCCTCGGCGGCGGGGCGG + Intronic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083753755 11:64778237-64778259 GGGCGGGGGCGGCGGCGGCCCGG + Exonic
1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG + Exonic
1083922313 11:65787501-65787523 GGGCACCCGCGGCGGCGTCGAGG + Intronic
1083970301 11:66070400-66070422 CGGCGGCGGCGGCGGGGGCGCGG - Intronic
1083970306 11:66070406-66070428 CCCCCGCGGCGGCGGCGGCGGGG - Intronic
1084053480 11:66616363-66616385 GAGCGGCGCCGGCGGCAGAGAGG - Intergenic
1084117043 11:67048613-67048635 GAGCAGCAGCGACGGCCGTGGGG + Exonic
1084148557 11:67277636-67277658 GAGCAGCTGCGGCCGCGCCAAGG - Intronic
1084151355 11:67289317-67289339 CGGCGGCGGCGGCGGCAGCGCGG - Exonic
1084271984 11:68033801-68033823 AAGTAGCGGCGGCGGCTGCCGGG - Intronic
1084284177 11:68120983-68121005 CAGCGGCAGCGGCGGCGGAGGGG + Exonic
1084284199 11:68121096-68121118 GAGCTGCGGTAGCGGCAGCGCGG - Exonic
1084310289 11:68312731-68312753 CAGCAGCGGCCACGGCGGCCCGG - Exonic
1084363740 11:68684822-68684844 GAGGAGCAGAGGCGGCGGCCGGG - Intronic
1085043969 11:73342943-73342965 CAGCAGCGCCGCCGGCGGCCGGG + Intronic
1085205827 11:74731359-74731381 TCCCAGCAGCGGCGGCGGCGCGG + Intronic
1085205830 11:74731362-74731384 CAGCAGCGGCGGCGGCGCGGCGG + Intronic
1085666234 11:78417699-78417721 CATGAGCGGCGGCGGCGACGTGG - Exonic
1086064566 11:82732566-82732588 GGGCGGCGGCGGCGGGGGCAGGG + Exonic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1087761744 11:102110375-102110397 GAGGCGGGGCCGCGGCGGCGCGG + Intergenic
1089432651 11:118436557-118436579 CACCGGGGGCGGCGGCGGCGGGG + Exonic
1089520041 11:119057243-119057265 GCGCCGGGGCGGCGGGGGCGGGG - Intergenic
1089543674 11:119206305-119206327 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1089993429 11:122882901-122882923 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1090042335 11:123301898-123301920 CAGCAGGGGCGGCGGCGGCCTGG + Intergenic
1090238259 11:125165060-125165082 GAGCAGCGCGAGGGGCGGCGAGG + Intronic
1090238280 11:125165145-125165167 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1090238397 11:125165529-125165551 GAGGAGCCGCGGCCGCGGCCTGG + Intronic
1090293888 11:125569551-125569573 GAGCCGCGGCGGCGGAGCTGTGG + Exonic
1090817784 11:130314444-130314466 AGGCGGCGGCGGCGGCGGCCCGG + Exonic
1091550286 12:1530981-1531003 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1091558577 12:1594153-1594175 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1091823258 12:3491752-3491774 GAGCGGCGGCGGCGGCGCGGTGG - Intronic
1091823259 12:3491755-3491777 GCTGAGCGGCGGCGGCGGCGCGG - Intronic
1092229052 12:6766755-6766777 GGGCGGGGGCGGCGGCGGCCCGG + Intronic
1092335408 12:7628703-7628725 GGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335416 12:7628724-7628746 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092335426 12:7628751-7628773 CGGCAGGGGCGGCGGCGGCAGGG - Intergenic
1092335432 12:7628766-7628788 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1092564205 12:9647962-9647984 CAGAAGCGCCGGCGGCTGCGGGG + Intergenic
1092743167 12:11649555-11649577 GAGGGGCGGCCGCGGGGGCGCGG - Intergenic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1093465067 12:19440194-19440216 GGGCAGCCAGGGCGGCGGCGGGG + Exonic
1093894822 12:24563347-24563369 GCACAGTGCCGGCGGCGGCGGGG - Intergenic
1094588673 12:31800980-31801002 GTGGAGGGGCGGCGGGGGCGGGG + Intergenic
1095752684 12:45729287-45729309 TTTCGGCGGCGGCGGCGGCGGGG - Intergenic
1096616034 12:52834119-52834141 GAGCAGTGGCAGTGGTGGCGGGG - Exonic
1096650363 12:53059397-53059419 GAGCAGTGGCGGCTGAGGCCAGG - Exonic
1096786852 12:54021766-54021788 CAGGAGCGGCTGCGGCGCCGTGG - Intronic
1096863763 12:54549324-54549346 GTGCAGCGGAGGCGGCGGGCTGG - Intergenic
1096983748 12:55743420-55743442 CGGCGGCGGCGGCAGCGGCGGGG + Exonic
1097190406 12:57216829-57216851 GAGCGGCGGGAGCGGCGGCGCGG - Exonic
1097929631 12:65169838-65169860 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1098105963 12:67069314-67069336 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
1098255429 12:68611075-68611097 AAGCCGCGGCGGCGGCCGCGCGG + Intronic
1098550372 12:71755138-71755160 GGCCGGCGGCGGCGGCGGCGGGG + Exonic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1099989756 12:89709268-89709290 GAGCAGCTGCGCCGCCAGCGTGG - Intronic
1100844396 12:98644581-98644603 GAGCAGCGGAGGCGGGGGCTGGG - Exonic
1101144785 12:101830840-101830862 CGGAAGCGGCGGCCGCGGCGCGG - Exonic
1101144828 12:101830950-101830972 AGGCGGCTGCGGCGGCGGCGGGG + Intergenic
1101592900 12:106139199-106139221 CGGCGGCGGCGGCGGCGGCCAGG + Exonic
1101680023 12:106955825-106955847 GAGCTGAGGAGGCGGCGGAGGGG + Exonic
1101813627 12:108129303-108129325 TGGCGGCGGCGGCAGCGGCGCGG + Intergenic
1101970718 12:109310079-109310101 GGGCAGCGGCGGCGCGGGCCGGG - Intergenic
1102197156 12:111033973-111033995 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1102371018 12:112382324-112382346 CGGCGGCGGCGGCGGCGGCAGGG - Intronic
1102456129 12:113071788-113071810 GGGCAGCGGCGGGCGCTGCGGGG + Intronic
1102457137 12:113077853-113077875 TGGCGGCGGCGGCGGCAGCGGGG - Exonic
1103424729 12:120823224-120823246 GGGGGGCGGCGGCGGTGGCGGGG + Intronic
1103424730 12:120823227-120823249 GGGCGGCGGCGGTGGCGGGGAGG + Intronic
1103433068 12:120904248-120904270 GGGCGGCGGCGGCGGCGGCCGGG + Exonic
1103509876 12:121467057-121467079 TCGCGGCGGCGGCGGCGTCGCGG + Intronic
1103595357 12:122021824-122021846 TGCCGGCGGCGGCGGCGGCGCGG + Exonic
1103623893 12:122204561-122204583 GCCGGGCGGCGGCGGCGGCGGGG - Exonic
1103721242 12:122976666-122976688 GTGGAGCGGCGGCAGCGGCTGGG + Exonic
1103749870 12:123151158-123151180 GAGCGGCGGCGGCGGCGGCGGGG + Intergenic
1103764669 12:123271665-123271687 GGGCGGCGGCGGCGGCGGCGAGG + Exonic
1103800356 12:123533735-123533757 CGGCGGCGGCGGCGGCAGCGGGG + Intergenic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1103935591 12:124474882-124474904 GTGCAGCTGCTGCGGGGGCGGGG - Intronic
1104030921 12:125065446-125065468 GGTCAGCGACGGCGGCGGCGGGG - Exonic
1104049563 12:125186488-125186510 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
1104376221 12:128267226-128267248 GAGCCGGAGCTGCGGCGGCGTGG + Intergenic
1104697097 12:130872011-130872033 GAGCAGGGGCGGGGCCGGCGCGG - Exonic
1104841458 12:131828041-131828063 GCGCTGCGGCGGCGGCTCCGGGG + Intergenic
1104961626 12:132490769-132490791 GACTCGCGGCGGCGGCGGCGCGG - Exonic
1105217489 13:18297632-18297654 GGGCAGCGGCGGCGGCGGCTAGG + Intergenic
1105472071 13:20703737-20703759 TCGGGGCGGCGGCGGCGGCGGGG + Intronic
1105745621 13:23375126-23375148 GAGCAGCGGCTGTGGCGCGGCGG - Exonic
1105943551 13:25171217-25171239 CGACAGCGGCGGGGGCGGCGGGG - Exonic
1105943641 13:25171586-25171608 CCGGAGCCGCGGCGGCGGCGGGG - Exonic
1106187805 13:27424565-27424587 GCGCAGCAGCGGCGCCGACGCGG + Exonic
1106241999 13:27920263-27920285 CGGGTGCGGCGGCGGCGGCGGGG - Exonic
1106322966 13:28659278-28659300 TGGCGGCGGCGGCGGCAGCGTGG + Intronic
1106340263 13:28820310-28820332 GCGCAGCCGCGGCGCGGGCGTGG + Intergenic
1106478031 13:30114805-30114827 GGGAGGCGGCGGCGGCGGCGGGG + Intergenic
1106516977 13:30464819-30464841 GCGCGGCGGCGGCGGCGGGCGGG + Intronic
1106517087 13:30465190-30465212 TCGCGGCGGCGGCGGCGGCCGGG - Intronic
1107468173 13:40667266-40667288 GAGCCGCGGCGCCGGGGGTGGGG - Intergenic
1107603920 13:42040491-42040513 GAGGAGGGGCGGCGGGGGGGAGG + Intronic
1107654124 13:42574398-42574420 GTGCGGCGCAGGCGGCGGCGGGG - Exonic
1108227465 13:48303971-48303993 GGGCGGCGGCGGCGGTGCCGGGG - Exonic
1108478512 13:50843686-50843708 GAGCAGCAGCGAGGGAGGCGGGG + Exonic
1109284858 13:60397600-60397622 AGGCGGCGGCGGCGGCGGCCTGG + Intronic
1110318202 13:74134290-74134312 GGGCGGGGGCGGCGGCGGGGAGG + Intergenic
1110558511 13:76886257-76886279 TGGCGGCGGCGGCGGCGGCGGGG - Exonic
1110596585 13:77326776-77326798 CGGCGGCGGCGGCGGCGGCGAGG - Intronic
1110596630 13:77326955-77326977 CAGTAGCGGCGAGGGCGGCGCGG - Intronic
1110630265 13:77698452-77698474 CAGCAGCGTGGGGGGCGGCGAGG - Intronic
1110705865 13:78601961-78601983 CAGCGGCGGCGGCGGCGGCCGGG - Exonic
1110705919 13:78602140-78602162 GGGGGGCGGCGGCGGCGGCCCGG - Exonic
1111397044 13:87677536-87677558 GTACGGCGGCGGCGGCGGCACGG + Exonic
1112050714 13:95642070-95642092 GGGCTGTGGCGGCGGCGGCCCGG - Exonic
1112091798 13:96090812-96090834 CGGCGGCGGCGGCGGCGGCAGGG - Intergenic
1112294779 13:98177080-98177102 GAGCAGCAGCAGCGGGGACGAGG - Exonic
1112504968 13:99970086-99970108 TGGTGGCGGCGGCGGCGGCGCGG + Intronic
1112505083 13:99970584-99970606 CGGCGGCGGCGGCGGCGCCGGGG + Exonic
1112507083 13:99981729-99981751 GAGCTGCGGCGGGGGCGGGCGGG - Intergenic
1112507851 13:99985565-99985587 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1112733692 13:102394694-102394716 GGGCAGCGGCGGCGGGACCGGGG + Intronic
1113200736 13:107866164-107866186 CGGCGGCGGCGGCGGCGGCAAGG - Exonic
1113312032 13:109140990-109141012 GGGCGGGGGCGGGGGCGGCGTGG - Exonic
1113377897 13:109782132-109782154 CAGCACCGGCGGCGGGTGCGGGG - Exonic
1113379060 13:109786486-109786508 CAGCAGCCCCGGCGGCGGCGCGG - Exonic
1113493624 13:110712408-110712430 GACCCGCGGCGGCCGCAGCGGGG + Intronic
1113541771 13:111115145-111115167 GCGGGGCGGCGGCGGCGGCTGGG - Intronic
1113541867 13:111115434-111115456 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1113542016 13:111115910-111115932 GAGGGGCGGCGCGGGCGGCGGGG + Intronic
1113655928 13:112067763-112067785 CGGGGGCGGCGGCGGCGGCGGGG + Exonic
1113794765 13:113050708-113050730 GAGCAGGGGGGGCGGGGGCGGGG + Intronic
1113835843 13:113328057-113328079 GAGCAGCCGCTGCGCCGGCTGGG - Intronic
1113861502 13:113490482-113490504 GAGCGGTGGCGTCGGAGGCGCGG - Intronic
1114037847 14:18646247-18646269 GAGCGGTGGCGGCTGTGGCGAGG - Intergenic
1114318322 14:21526272-21526294 GAGCAGCGGCGGAGGGGGAGGGG + Intronic
1115028336 14:28767242-28767264 GGGAAACGGCGGCGGCGGCGCGG - Exonic
1115235793 14:31207670-31207692 GGGCGACGGCGGCGGCGGCGCGG + Intronic
1115399144 14:32938833-32938855 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115761311 14:36581057-36581079 CGGCGGCGGCGGCGGTGGCGAGG - Exonic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1116018241 14:39432044-39432066 CAGCAGCTGCGACGGCTGCGGGG - Exonic
1116658092 14:47675472-47675494 GAGCGGTGGCGGTGGCGGCTGGG - Intergenic
1116895514 14:50311969-50311991 GGGCAGCAGCGCAGGCGGCGGGG + Intronic
1116895515 14:50311972-50311994 CAGCAGCGCAGGCGGCGGGGAGG + Intronic
1117602581 14:57390672-57390694 GAGTGGCGGCAGCGGCGGCGGGG + Exonic
1117647367 14:57865997-57866019 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
1117675595 14:58152105-58152127 GGACAGAGGCAGCGGCGGCGCGG + Exonic
1117875931 14:60249727-60249749 GCGCGGCGGCGGCGGCGGGCAGG + Intronic
1117898271 14:60509374-60509396 AGGCAGTGCCGGCGGCGGCGAGG - Exonic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118137431 14:63045301-63045323 GGGGCGCGGCGGCGGCGACGGGG + Exonic
1118350999 14:64972366-64972388 GGGCGGCGGCGGCGGCGCAGGGG - Intronic
1118809215 14:69261206-69261228 GCACAGCGGGGGCGGCGGCGGGG + Intronic
1118849484 14:69573097-69573119 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1119158779 14:72435752-72435774 CAGCAGGGGCGGGGGCGGGGTGG - Intronic
1119249036 14:73136548-73136570 GAGCCGCGGCGGCAGCGGGGCGG + Exonic
1119322229 14:73738960-73738982 GAGAGGCGGCGGGAGCGGCGGGG + Exonic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1119759659 14:77141547-77141569 GCAGTGCGGCGGCGGCGGCGCGG - Intronic
1120167902 14:81220357-81220379 CGGCGGCGGCGGCGGCCGCGCGG + Intronic
1120788023 14:88554722-88554744 GTGCGGCTGCGGCGGCCGCGCGG - Exonic
1121050439 14:90816332-90816354 GCGCCGCGGCGGCGGCGGTGGGG - Exonic
1121074973 14:91060398-91060420 TGGCAGCAGCGGCGGCGCCGCGG - Exonic
1121075000 14:91060502-91060524 GGGCCGCGGCAGCGGCTGCGAGG - Exonic
1121253055 14:92513803-92513825 GCGCGGCGGCAGCGGCGGCCTGG + Exonic
1121767800 14:96502536-96502558 CGGCAGCGGCGGCGGTTGCGGGG + Exonic
1122081692 14:99271296-99271318 CGGCAGCGGCGGCAGCGGCGCGG - Intronic
1122108801 14:99480915-99480937 GAACGGCGGCGGCTGCGGCCCGG - Intergenic
1122130725 14:99603446-99603468 AAGCGGTGGCGGCGGCGGCGGGG - Exonic
1122183495 14:99971987-99972009 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1122445019 14:101761787-101761809 CGGCGGCGGCGGCGGCCGCGGGG + Exonic
1122470798 14:101964700-101964722 GCCCGGGGGCGGCGGCGGCGAGG + Exonic
1122486761 14:102087141-102087163 GCGCGGCCGCGGCGGCGGCTGGG - Intronic
1122517623 14:102319807-102319829 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1122581986 14:102777133-102777155 GACGCGCGGCGGCGGGGGCGCGG + Intergenic
1122620714 14:103056560-103056582 GAGGTGCGGGGGCGGGGGCGGGG + Intronic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122620963 14:103057476-103057498 AGTCTGCGGCGGCGGCGGCGGGG - Intergenic
1122689120 14:103523186-103523208 CAGCCCCCGCGGCGGCGGCGAGG + Intergenic
1122736669 14:103847515-103847537 AGGCGGCGGCGGCGGCGGCCGGG - Exonic
1122779157 14:104136372-104136394 GCGCGGCGGCGGCGGGCGCGCGG + Intergenic
1122959422 14:105087664-105087686 GAGCAGCGGCGGGGCGGGCGGGG + Intergenic
1122975252 14:105168328-105168350 GCGGGGCGGCGGGGGCGGCGGGG - Intronic
1122975294 14:105168445-105168467 GGGCGCGGGCGGCGGCGGCGGGG - Exonic
1122975332 14:105168543-105168565 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1122993301 14:105248983-105249005 GGGCGGCGGCGGCGCTGGCGCGG - Exonic
1123001926 14:105300473-105300495 GAGCAGCGGCGGCGGCTCCTCGG - Exonic
1123024040 14:105415227-105415249 GAGCCGCGCGGGCGGGGGCGCGG + Intronic
1202940286 14_KI270725v1_random:138322-138344 AAGCCGCGAGGGCGGCGGCGGGG + Intergenic
1123684351 15:22786685-22786707 CGGCGGCGGCGGCGGCGGCCGGG + Exonic
1124014284 15:25862936-25862958 GGCGAGCGGCGACGGCGGCGCGG - Exonic
1124029701 15:25999308-25999330 AGGCGGCGGCGGCGGCGGCCTGG - Intergenic
1124109366 15:26772623-26772645 GACCCACGGCGGCGGCGGCCTGG - Intronic
1124426826 15:29570141-29570163 GAGCGGCCGCGGCCGAGGCGAGG - Intronic
1124427040 15:29570927-29570949 GCGGCGCGGCGGCGGCGGCATGG - Intergenic
1124469271 15:29968790-29968812 CGGCGGCGGCGGAGGCGGCGGGG - Intronic
1124922311 15:34038911-34038933 CGGCGGCGGAGGCGGCGGCGGGG - Exonic
1124929143 15:34101889-34101911 CAGCGGCGGCGGTGGCGGCCGGG - Exonic
1124971126 15:34490500-34490522 GGGCGGCGGGGGCGGCGGCGGGG - Intergenic
1125033067 15:35092456-35092478 CAGCAGGGGCGGCGGCGGGTGGG + Intergenic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1125200730 15:37098988-37099010 GCGCAGCGGCTGCGGCAGCGCGG + Intronic
1125429528 15:39581179-39581201 GAGCGGTGGCGAGGGCGGCGAGG - Exonic
1125508789 15:40282031-40282053 CCGCAGCGGCGGCGGCGGCGCGG + Exonic
1125522928 15:40358232-40358254 TGGCGGCGGCAGCGGCGGCGGGG - Exonic
1125522960 15:40358342-40358364 CAGCAGCGGCGGCAGCGGTCCGG + Exonic
1125539581 15:40462217-40462239 CGGCGGCGACGGCGGCGGCGAGG - Exonic
1125834456 15:42737161-42737183 GAGGGGCGGGGCCGGCGGCGGGG + Intergenic
1126034959 15:44537199-44537221 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1126109483 15:45167146-45167168 CAGCCGGGGCGGGGGCGGCGGGG + Intergenic
1126852399 15:52805379-52805401 AGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1127165765 15:56243783-56243805 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1127165776 15:56243817-56243839 CGGCGGCCGCGGCGGCGGCGGGG - Intergenic
1127439028 15:58987745-58987767 CGGCAGTGGCGGCGACGGCGAGG + Intronic
1127458798 15:59179133-59179155 GAGCAGGGGCAGAGGCGCCGAGG - Intronic
1127515521 15:59689393-59689415 GCGTGGCGGCGGCGGAGGCGTGG + Exonic
1127995589 15:64151753-64151775 GAGCAGCTGGGGCCGGGGCGCGG + Exonic
1128067858 15:64775603-64775625 CGGCGGCGGCAGCGGCGGCGGGG + Intergenic
1128322667 15:66703914-66703936 GAGCAGCAGCTGCGGCGGCGCGG - Exonic
1128344127 15:66842819-66842841 GGGCGGCGGCGGCGCCGGCGCGG + Intergenic
1128454156 15:67823353-67823375 GCGCGGCGGCGGGGACGGCGCGG - Intronic
1128454949 15:67827103-67827125 TGGGAGCGGCGGCGGCGGCGCGG + Intronic
1128841472 15:70854235-70854257 CGGCGGCGGCGGCGGCGGCGCGG - Intronic
1129116413 15:73367761-73367783 CTGCTGGGGCGGCGGCGGCGAGG + Exonic
1129116453 15:73367931-73367953 GGGCGGCGGCAGCGGCGGCACGG - Exonic
1129273885 15:74433259-74433281 GAAGCGCGGCGGCGGCGGCAAGG + Intronic
1129299243 15:74615926-74615948 CGACAGCGGCGGCGGCGGCCGGG + Intronic
1129710701 15:77819133-77819155 GAGCCTCGGGGGCAGCGGCGGGG - Intronic
1129752793 15:78077604-78077626 GGAGGGCGGCGGCGGCGGCGAGG - Exonic
1129752822 15:78077691-78077713 GCGCAGCGGCCGCGGCGCGGAGG - Intronic
1130040839 15:80404345-80404367 GGCGAGCGGCCGCGGCGGCGGGG + Exonic
1130115461 15:81001575-81001597 AAGCGGCGCCGGCGGCAGCGGGG - Exonic
1130348052 15:83067065-83067087 GGGCGGCGGCGGCGGCCCCGCGG + Exonic
1130362959 15:83207681-83207703 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1130390181 15:83447834-83447856 GGGCAGAGGTGGCGGCCGCGGGG + Intronic
1130613355 15:85380905-85380927 GAGGAGGGGCGGGGGCTGCGGGG + Intronic
1130656435 15:85794779-85794801 CTGAGGCGGCGGCGGCGGCGGGG - Exonic
1131144431 15:90002021-90002043 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1131367664 15:91853715-91853737 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1131367719 15:91853881-91853903 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1131475398 15:92734255-92734277 GGAGAGCGGCGGCGGCGGCGCGG - Intronic
1131693881 15:94855573-94855595 CTGAGGCGGCGGCGGCGGCGAGG + Intergenic
1131827015 15:96330404-96330426 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1132055558 15:98648545-98648567 TGGCAGCGGCGGCGGCGGCGCGG + Intergenic
1132589959 16:722268-722290 GAGTAGAGGGGGCGGGGGCGGGG - Intronic
1132604651 16:788627-788649 GCGCGACGGCGGCGGCGGCGCGG + Exonic
1132641879 16:981786-981808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1132698549 16:1212557-1212579 GAGCAGCGGCCGCAGAAGCGGGG - Intronic
1132839488 16:1972146-1972168 GAGCGGCGGCGGCGGCAACATGG + Exonic
1132887781 16:2190023-2190045 GGGCAGGGGCGGGGGCAGCGAGG - Intronic
1133040884 16:3059247-3059269 GCGCAGGGGCGGCGGCGGCGGGG + Exonic
1133079289 16:3305691-3305713 GAGCGGCGGCGGCCGCAGGGAGG + Intronic
1133140623 16:3741143-3741165 GAGGAGGGGTGGCGGCGGGGAGG - Intronic
1133156451 16:3880136-3880158 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
1133212873 16:4272868-4272890 TGGCGGCGGCGGCGGCGGCGAGG + Exonic
1133270950 16:4610591-4610613 GGGCAGCGGCAGGGCCGGCGGGG - Intronic
1133304874 16:4802536-4802558 TGGCAGCGACGGCGGCGGAGCGG - Exonic
1133784357 16:8963367-8963389 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1133801927 16:9091702-9091724 CAGCGGCGGCGGCGGCAGTGGGG + Exonic
1133802027 16:9092003-9092025 ACGCGGCGGCGGTGGCGGCGAGG + Exonic
1133972881 16:10580091-10580113 GAGCAGCGGCGGGGGCCTAGAGG + Intronic
1134149873 16:11797189-11797211 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1134149884 16:11797243-11797265 TAGCGGCGGCGGCAGCGGCTCGG + Intronic
1134172080 16:11976756-11976778 AAGCGGCAGCGGCGGCGGCGCGG + Exonic
1134419324 16:14071340-14071362 GAGCGGCGGCGGCGGCGGCCGGG + Intronic
1135250866 16:20900307-20900329 AAGAAGAGGCGGCGGCGGCGGGG - Exonic
1135296538 16:21283936-21283958 CAGCGGCGGAGGCGGCGGCGAGG + Intronic
1135691319 16:24539913-24539935 CCGAGGCGGCGGCGGCGGCGGGG + Intronic
1135725981 16:24854170-24854192 GAGGAGGGGCGGCGGCTGCCTGG - Intronic
1135821870 16:25692319-25692341 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1135822009 16:25692804-25692826 GAGCGGCGGCGGAGGCGCCCAGG + Exonic
1136110894 16:28063205-28063227 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1136237764 16:28925108-28925130 GATGAGCGGCGGCGGCGGCCGGG - Exonic
1136378147 16:29877357-29877379 GAGGAGAGAAGGCGGCGGCGCGG + Exonic
1136399510 16:30010069-30010091 GGGCGGCGGGGGCGGCGGGGAGG - Exonic
1136408520 16:30063738-30063760 GGGCAGCAGCGGGGGCAGCGAGG - Exonic
1136498834 16:30659685-30659707 GGGCGGCGGCGGCGACGACGAGG - Exonic
1136699099 16:32116088-32116110 AAAAAGCCGCGGCGGCGGCGGGG - Intergenic
1136768591 16:32812004-32812026 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
1136957297 16:34802437-34802459 GAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1136957370 16:34802692-34802714 AAAAAGCCGCGGCGGCGGCGGGG - Intergenic
1137426572 16:48385377-48385399 CGGCGGCGGCGGCGGCGGCCAGG - Intronic
1137617264 16:49855507-49855529 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
1137617692 16:49856917-49856939 AGGCGGCGGCGGCGGCGGCCGGG + Intronic
1137668617 16:50266484-50266506 CAGCGGCGGCGGCGGCAGCAAGG - Intronic
1137708014 16:50548611-50548633 CCGCGGCGGCGACGGCGGCGGGG - Intronic
1137926719 16:52547324-52547346 GAGAGGGGGCGGCCGCGGCGGGG - Intronic
1137988671 16:53131124-53131146 GAGCAGCGGCCGCTGCCCCGCGG - Intronic
1138105698 16:54286157-54286179 GCGCAGCGCGGGCGGCAGCGCGG - Exonic
1138105710 16:54286212-54286234 CGGCGGCGACGGCGGCGGCGAGG + Exonic
1138179320 16:54931408-54931430 CGGCGGCGGCGGCGGCCGCGGGG - Exonic
1138247625 16:55479279-55479301 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1138328067 16:56191748-56191770 AGGAGGCGGCGGCGGCGGCGCGG - Intronic
1138450773 16:57092561-57092583 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1138686946 16:58734147-58734169 TGGCAGAGGCCGCGGCGGCGAGG + Exonic
1139402939 16:66696649-66696671 GAGAGGCGGCGGCGGCGGGCGGG - Exonic
1139433811 16:66925149-66925171 GAACGGCGGCGGCAGCGGAGCGG - Exonic
1139446268 16:67000604-67000626 AGGTAGCGGCGGCGGCCGCGGGG - Intronic
1139451167 16:67029123-67029145 CGGCGGCGGCGGCGGCGGCCGGG + Intronic
1139451188 16:67029194-67029216 CGGCGGCGGCGGCGGCGGCGTGG + Intronic
1139469448 16:67170484-67170506 CAGCTGCGGCGGGGGCGGGGCGG - Intronic
1139469449 16:67170487-67170509 CAGCAGCTGCGGCGGGGGCGGGG - Intronic
1139546627 16:67652855-67652877 CAGCGGCGGCGGCGGGGGAGGGG + Intronic
1140087312 16:71808698-71808720 GAGCGCCCGCGGCAGCGGCGGGG + Intronic
1140223160 16:73058355-73058377 GAGCGCGGGCGGCGGCGGCCGGG + Intronic
1140476949 16:75243872-75243894 GGGCAGCAGCGGCAGGGGCGAGG - Intronic
1140504810 16:75464564-75464586 GAGCGGCGGCAGCGGCGGGTCGG - Exonic
1140927579 16:79599191-79599213 CGGCGGCGGCGGAGGCGGCGGGG - Exonic
1141079183 16:81035881-81035903 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
1141141179 16:81497796-81497818 CAGCAGCAGAGGAGGCGGCGGGG - Intronic
1141608579 16:85169249-85169271 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1141627116 16:85267149-85267171 GAGCAGCGGCGGTGGCTGCCTGG + Intergenic
1141682596 16:85553290-85553312 CAGCGGCGGCGGCGGCGGCCTGG - Intergenic
1141831164 16:86510608-86510630 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1141989702 16:87602832-87602854 GGGCAGGAGCGGCGGCGGCGGGG - Intronic
1142184068 16:88686177-88686199 GCGCAGCGGCTGCGGCTGCAGGG - Intronic
1142240187 16:88941398-88941420 GTGGCGCAGCGGCGGCGGCGGGG - Intronic
1142336096 16:89490350-89490372 AGGCGGCGGCGGCGGCGGCGCGG + Exonic
1142395346 16:89828562-89828584 GGGCAGCTGCGGCGGCGCCGCGG + Exonic
1142417206 16:89949181-89949203 GAGCAGCGGCGGCGTCCCCGGGG - Intronic
1203070913 16_KI270728v1_random:1073770-1073792 AAGCAGCGGCGGTGGCGGCGGGG + Intergenic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1203071017 16_KI270728v1_random:1074139-1074161 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
1142509772 17:386106-386128 GCTCAGCGGCGGGGCCGGCGGGG - Intronic
1142586746 17:979116-979138 GGGCAGAGGCGGGGACGGCGGGG + Intronic
1142611009 17:1109229-1109251 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1142709618 17:1716006-1716028 GAGAAGGGGCGGCGGGGGCAGGG - Intergenic
1142812316 17:2401108-2401130 TAGTAGCGGGGGCGGCGGCCGGG - Exonic
1142836798 17:2593599-2593621 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1143063341 17:4222164-4222186 TAGCAGCAGCGGCGGCGGCGGGG - Intronic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143223654 17:5282376-5282398 GGGCGGCGGCGGCGGCGGCTCGG + Exonic
1143329058 17:6120672-6120694 ACTCAGCGGGGGCGGCGGCGTGG - Exonic
1143527220 17:7479595-7479617 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
1143582641 17:7835677-7835699 GGGCAGCGGCGGAGGCTGGGAGG + Intergenic
1143590782 17:7885057-7885079 CGGCGGGGGCGGCGGCGGCGGGG - Exonic
1143590877 17:7885306-7885328 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1143772526 17:9177769-9177791 GTGCAGAAGAGGCGGCGGCGAGG - Intronic
1143830300 17:9645678-9645700 GAGCGGCGGCGGCGGGGCCGGGG - Exonic
1144021030 17:11240630-11240652 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1144021161 17:11241057-11241079 CGGCGGCGGCGGCGGCGGCGTGG - Intergenic
1144109808 17:12020904-12020926 GAGCGGCGGCGGCGGCTCCGGGG + Exonic
1144775650 17:17783341-17783363 GGGCTGCGGAGGCGGCGGCGCGG + Intronic
1144953033 17:19004220-19004242 GGGGAGGGGCGGCGGGGGCGGGG + Intronic
1145690064 17:26731200-26731222 AAAAAGCTGCGGCGGCGGCGGGG - Intergenic
1145694205 17:26774511-26774533 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1146034098 17:29390838-29390860 AACAAGGGGCGGCGGCGGCGGGG - Exonic
1146132634 17:30291961-30291983 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146255884 17:31391531-31391553 CGGCGGGGGCGGCGGCGGCGGGG - Intergenic
1146356923 17:32142450-32142472 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1146371092 17:32266006-32266028 GCGAGGAGGCGGCGGCGGCGCGG + Intergenic
1146371114 17:32266062-32266084 GAGCGGGCGCGGAGGCGGCGCGG + Intergenic
1146398658 17:32487295-32487317 CCGCAGCGGCGGCGGCGGGCGGG + Intronic
1146403672 17:32519463-32519485 GGGCTCTGGCGGCGGCGGCGGGG + Intronic
1146763486 17:35498065-35498087 GAGCGGCGGCGAGGGCGGCGGGG + Intronic
1147393183 17:40122366-40122388 CGGCAGCAGAGGCGGCGGCGAGG + Intronic
1147571158 17:41571935-41571957 CCGCAGCGGCGGGGGTGGCGGGG - Exonic
1147720440 17:42536467-42536489 CAGCCTGGGCGGCGGCGGCGCGG + Exonic
1147793080 17:43025281-43025303 GGGCGGGGGAGGCGGCGGCGGGG + Exonic
1147994707 17:44354407-44354429 GGGCGGCGGGGGCGGCGGCGAGG - Exonic
1148126934 17:45241982-45242004 GGGCAGCGGCGGCGCAGGCGGGG - Exonic
1148139236 17:45316829-45316851 GAGCAGTGGGGTCGGCGGCCAGG - Intronic
1148178080 17:45584879-45584901 GGGCAGCGGCAGCGGCGGCGGGG + Intergenic
1148178083 17:45584885-45584907 CGGCAGCGGCGGCGGGGCCGGGG + Intergenic
1148323786 17:46771927-46771949 GAGGCGCGGCGGCGGCGCGGCGG - Intronic
1148495011 17:48048384-48048406 GGCCGGCGGTGGCGGCGGCGAGG + Exonic
1148551068 17:48551101-48551123 GGGCGGTGGCGGCGGCGGCGGGG - Exonic
1148555834 17:48578059-48578081 GGGCGGTGGCGGGGGCGGCGGGG + Exonic
1148556182 17:48580158-48580180 GCGCGGCGGCGGCGGAGGCAAGG - Intronic
1148556596 17:48582227-48582249 GCGCACCGGCGGCGGCGGCGCGG + Intronic
1148557030 17:48584924-48584946 GACTAGCGGCGGGGGCGGGGTGG - Intronic
1148786838 17:50149734-50149756 GGCGGGCGGCGGCGGCGGCGGGG + Exonic
1149296276 17:55265034-55265056 GAGCAGCGGCCGCCGGCGCGGGG + Exonic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1149610527 17:57955323-57955345 CAGGCTCGGCGGCGGCGGCGCGG + Exonic
1149840935 17:59964567-59964589 GGGCAGAGGAGGAGGCGGCGAGG - Intronic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150060586 17:62065372-62065394 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1150407976 17:64919169-64919191 GGGCGGCGGCGGCGGCGGCGGGG + Intronic
1150561923 17:66302329-66302351 CGGCGGCGGCGGCGGCGGCCGGG - Intergenic
1150692297 17:67377231-67377253 CAGCAGCGGCCGCGGCGGGGAGG - Intergenic
1150692298 17:67377234-67377256 CATCAGCAGCGGCCGCGGCGGGG - Intergenic
1150692751 17:67378866-67378888 GAGCGGCGGGGGCTGCGACGCGG + Intronic
1150747244 17:67825792-67825814 CGGCGGCGGCGGTGGCGGCGGGG - Exonic
1150764625 17:67993545-67993567 GCGCGGCGGCGGCGCGGGCGCGG + Intronic
1151477825 17:74353845-74353867 GAGCGGAGGCGGCGGGGGAGGGG - Intronic
1151478543 17:74356878-74356900 CAGCAGCGGCGGCGACGCGGCGG - Exonic
1151478545 17:74356881-74356903 GGCCAGCAGCGGCGGCGACGCGG - Exonic
1151565084 17:74893278-74893300 GTGCGGCGGAGGTGGCGGCGCGG - Intronic
1151711412 17:75809081-75809103 GAGCGGCGGGGGCGGGGGCGGGG + Intronic
1151743653 17:76000598-76000620 GTGCAGCGCCGGCGGGGGCCAGG + Intronic
1151828694 17:76537570-76537592 GCTCGGCGGCGGCGGTGGCGGGG + Exonic
1151876067 17:76868846-76868868 GTGCAGCGGAGGGAGCGGCGCGG - Intronic
1152049183 17:77959081-77959103 CGGCGGCTGCGGCGGCGGCGCGG - Intergenic
1152174926 17:78781611-78781633 GGGGAGCGGCGCCGCCGGCGAGG - Intronic
1152222211 17:79075062-79075084 CGGCCGCGGCGGCGGCGGCCGGG + Exonic
1152324493 17:79627665-79627687 GAGCAGCGGCGTAGGTGGCTGGG + Intergenic
1152362538 17:79839347-79839369 GGCGAGCGGCGGCGGCGGCGGGG - Exonic
1152628601 17:81399638-81399660 GCGCAGAGGCGGCGGCGTCCGGG - Exonic
1152711211 17:81871222-81871244 GGGGACCGGCGGCGCCGGCGGGG - Intronic
1152721879 17:81927468-81927490 GCGGCGCGGCGGGGGCGGCGGGG - Intronic
1152729025 17:81960944-81960966 AGGCGGCGGCGGCGGCGGCGGGG + Exonic
1152730686 17:81968130-81968152 AAAGAGGGGCGGCGGCGGCGGGG + Intergenic
1152758960 17:82098452-82098474 GAGGAGCGCCGGGGGCGGGGCGG + Intergenic
1152798749 17:82321574-82321596 GGGAGGCGGCGGCGGCGGCTCGG - Exonic
1152817833 17:82418662-82418684 GAGCGGAGGCGGCGGCCGCGAGG + Exonic
1152924158 17:83079889-83079911 CAGCAGCGGGAGCGGCGGCGGGG - Exonic
1203192332 17_KI270729v1_random:200551-200573 AAAAAGCGGCGGCGGCGGCGGGG - Intergenic
1152952808 18:10929-10951 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952815 18:10958-10980 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952822 18:10987-11009 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952829 18:11016-11038 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1152952836 18:11045-11067 GCGCAGCGCCGGCGCAGGCGCGG + Intergenic
1153052190 18:909449-909471 GAGCCTCGGCGGCGGCGCGGGGG + Exonic
1153285384 18:3450967-3450989 GGGCGGCGGGGGCGGGGGCGGGG - Intronic
1154173772 18:12068425-12068447 CCCCGGCGGCGGCGGCGGCGCGG - Intergenic
1154174488 18:12076537-12076559 CGGCGGCGGCGGCGGCGCCGCGG - Intergenic
1154214870 18:12408307-12408329 GAGCGGGGGCGGCCGGGGCGGGG + Intronic
1154323494 18:13372868-13372890 GAGCAGGGGCCGAGGCGGCATGG + Intronic
1155392757 18:25352413-25352435 CGGCGGCGACGGCGGCGGCGCGG - Intergenic
1156243036 18:35271861-35271883 CAGCAGCTGCGGAGGGGGCGCGG - Intronic
1157136675 18:45063475-45063497 CAGGGGCGGCGGCGGTGGCGGGG - Exonic
1157383818 18:47246661-47246683 CAGGGGCGGCGGCGGGGGCGGGG + Intronic
1157383938 18:47247081-47247103 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1157383959 18:47247156-47247178 AAGCGGCGACGGCGGCTGCGGGG + Intronic
1157384298 18:47248308-47248330 CGGTGGCGGCGGCGGCGGCGGGG + Intronic
1157849137 18:51030715-51030737 CGGCGGCGGCGGCGGCGGCTGGG + Intronic
1157867051 18:51196766-51196788 CGGCCGCGGCGGCGGCGGCGGGG - Exonic
1157867202 18:51197234-51197256 CGGTGGCGGCGGCGGCGGCGGGG + Exonic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158259108 18:55588155-55588177 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1158435996 18:57435833-57435855 CAGTGGCGGGGGCGGCGGCGGGG + Exonic
1158436001 18:57435842-57435864 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1158436007 18:57435854-57435876 GGGCGGCGGGGGCGGCGGCGGGG + Exonic
1158601938 18:58863501-58863523 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1158954139 18:62523552-62523574 GGGCGGCGGCGGCGGCGGCGGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1159798237 18:72868237-72868259 GGGCCGCGGCGGCGGCAGCAAGG + Intergenic
1160025389 18:75211660-75211682 AGGCGGCGGCGGCGGCCGCGCGG - Intronic
1160453340 18:78979743-78979765 GCCCGGCGGCGGCGGCGGGGGGG + Intergenic
1160453445 18:78980154-78980176 GCGGGGCGGCGGCGGCTGCGCGG - Intergenic
1160631187 18:80247367-80247389 GAGGAGCGAGGGCGACGGCGAGG - Exonic
1160680328 19:409175-409197 ATACGGCGGCGGCGGCGGCGGGG - Intergenic
1160706308 19:531787-531809 GGGCGGCGGCGGCGGCGCAGAGG + Exonic
1160706346 19:531916-531938 GAGCCATGGCGGCGGCGGAGGGG - Exonic
1160738811 19:676606-676628 GGGGCGCGGCGGCGGCGGCGGGG + Intronic
1160738813 19:676612-676634 CGGCGGCGGCGGCGGGGGCGAGG + Intronic
1160812976 19:1020933-1020955 CAACGGCGGCGGCGGCGGCCCGG - Exonic
1160858683 19:1228560-1228582 CGGCAGCAGCGGTGGCGGCGCGG + Exonic
1160861232 19:1237969-1237991 GCGCAGCGGGGGCGGCGGGCCGG - Exonic
1160888227 19:1362392-1362414 GCTCAGAGGCAGCGGCGGCGGGG + Intronic
1160896940 19:1407554-1407576 GCGCAGGGGCGGCGGCGCGGCGG + Intronic
1160904642 19:1446414-1446436 GAACAGCGGGCGCGGCGGCGGGG + Intronic
1160904715 19:1446676-1446698 GGGCGGCGGGGGCGGCTGCGGGG + Intronic
1160930465 19:1567639-1567661 CCGGGGCGGCGGCGGCGGCGGGG + Exonic
1160930588 19:1567995-1568017 GGGCGGCGGCGGCGGCGGCGTGG - Exonic
1160930703 19:1568310-1568332 CCGAGGCGGCGGCGGCGGCGCGG + Intergenic
1160967699 19:1753830-1753852 CGGCGGCGGCGGCGGCGGTGGGG + Exonic
1160967715 19:1753875-1753897 GGGCAGCGCGGGCGGCGGCGCGG + Exonic
1160967917 19:1754583-1754605 GAGCGGCGGCGGCCCCAGCGCGG + Exonic
1161069657 19:2253726-2253748 GGGCGGCGGCGGCGGCTGCAGGG + Exonic
1161072421 19:2269531-2269553 GGCGAGCAGCGGCGGCGGCGCGG + Exonic
1161388141 19:4007794-4007816 GAGCGGTGGCGGCGCCGGCCGGG + Intronic
1161397981 19:4054692-4054714 CAGCGGCGGCGGCGGCCGCGGGG + Exonic
1161443362 19:4304848-4304870 GAGCAGCTGGGGTGGAGGCGGGG - Intronic
1161461544 19:4400501-4400523 GAGCGGCTGAGGCGGCGCCGGGG - Exonic
1161477444 19:4494343-4494365 GGGCAGCGGCGGCAGCAGCGGGG + Exonic
1161607524 19:5223046-5223068 GAGCCGCGGCGGCCTGGGCGAGG - Exonic
1161816392 19:6502257-6502279 GGGGAGCTGCGGCGGCGGCGAGG + Exonic
1162027709 19:7903919-7903941 GCGCGGCGGCGGTGGCGGCGGGG + Exonic
1162033206 19:7926052-7926074 CGGCGGCGGCGGCGGCGGCCCGG + Exonic
1162145510 19:8610664-8610686 AGACAGCGGCGGCGACGGCGCGG - Intronic
1162372932 19:10289868-10289890 GGGCGGCGGCAGAGGCGGCGGGG - Intergenic
1162378454 19:10318318-10318340 GAGCAGCGGTGGGAGTGGCGGGG - Exonic
1162396633 19:10421043-10421065 TGGCACCGGCAGCGGCGGCGCGG + Exonic
1162435356 19:10654715-10654737 TGGCGGCTGCGGCGGCGGCGAGG + Intronic
1162470875 19:10871493-10871515 CGGTGGCGGCGGCGGCGGCGAGG + Exonic
1162470927 19:10871662-10871684 GCGCAGCGGCGGCGGCGGCGGGG + Exonic
1162470940 19:10871707-10871729 CAGCGGCGGCGGCGGCGGTGGGG + Exonic
1162535840 19:11262478-11262500 GGGAGGCGGCGGCGGCGGCGGGG - Intronic
1162572144 19:11480030-11480052 CAGCAGCGGCGGCGGGCCCGCGG + Intronic
1162731421 19:12721215-12721237 GGCCACAGGCGGCGGCGGCGGGG + Intronic
1162752683 19:12838505-12838527 AGGCGGCGGCGGCGGCGGCGCGG - Intronic
1162817921 19:13207549-13207571 GGGCAGCGGGGGCGGCGAGGAGG - Exonic
1162929879 19:13952554-13952576 GAGCGGCGGCGGCGGCCCCGGGG + Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1162954500 19:14090779-14090801 GTGCGGCGGCGGCGGCGGCGGGG - Intronic
1163106329 19:15125029-15125051 CAGCGGGGGCGGCGGCCGCGGGG + Exonic
1163138809 19:15332498-15332520 CGGCGGCGGCGGCGGCGGCTGGG - Intronic
1163154494 19:15432540-15432562 TGGGGGCGGCGGCGGCGGCGCGG + Intronic
1163154497 19:15432543-15432565 GGGCGGCGGCGGCGGCGCGGGGG + Intronic
1163282312 19:16325322-16325344 GGGCGGCGGCGGCGGCTCCGGGG - Exonic
1163364576 19:16868862-16868884 CAGCAGCGGAGGCGGGGGCTTGG + Intronic
1163398089 19:17075763-17075785 GGGGAGCGGCGGGCGCGGCGGGG + Exonic
1163398090 19:17075766-17075788 GAGCGGCGGGCGCGGCGGGGCGG + Exonic
1163441292 19:17323805-17323827 CGGCATTGGCGGCGGCGGCGCGG + Exonic
1163442453 19:17328764-17328786 GGGCGGCGGCAGCGGGGGCGGGG - Exonic
1163442457 19:17328770-17328792 GGGCGGGGGCGGCGGCAGCGGGG - Exonic
1163631397 19:18419620-18419642 GGGCCCCGGCGGCGGCGGCGTGG + Exonic
1163633701 19:18429139-18429161 GAGCAACGGAGGCGACGGCCCGG - Intronic
1163655673 19:18543534-18543556 GAGGCGCGGCGGCCGCGGCTGGG - Exonic
1163664141 19:18595189-18595211 CAGCAGGGGCGGCGGGGGCCGGG - Intronic
1164594964 19:29526524-29526546 GCGGAGAGGCGGCGGCCGCGTGG - Exonic
1164835580 19:31353138-31353160 CAGAAGCGGCCGCGGCGGCGCGG + Intergenic
1165204513 19:34172431-34172453 CGGCGGCAGCGGCGGCGGCGCGG - Intergenic
1165274281 19:34734392-34734414 GAGTCCCGGGGGCGGCGGCGGGG + Intronic
1165432569 19:35780985-35781007 CGGCAGCGGCTGCGGCAGCGGGG + Exonic
1165493913 19:36141038-36141060 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1165774034 19:38394757-38394779 GAGGAGCGGCGGCGCTGGGGGGG - Exonic
1165961616 19:39539777-39539799 GCCCGGCGGCGGCGGCGGCCAGG - Exonic
1166304250 19:41928589-41928611 TGGAGGCGGCGGCGGCGGCGCGG + Intronic
1166361247 19:42253856-42253878 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1166695742 19:44850727-44850749 GAGCAGCGGCTGCAGCAGCCAGG - Intronic
1166803694 19:45472768-45472790 GGGCAGGGGCGGTGGTGGCGGGG - Exonic
1166852849 19:45768692-45768714 GTGAGGCGGCGGCGGCGGCCGGG - Exonic
1166882982 19:45940292-45940314 GGGAGGCGGGGGCGGCGGCGGGG + Exonic
1166888057 19:45973451-45973473 TTGCGGCGGCGGCGGCGGCGGGG + Exonic
1167040608 19:47020786-47020808 GCGCGGGGGAGGCGGCGGCGGGG + Intronic
1167134296 19:47608243-47608265 GAGCCACGGCGGCGCCGGGGAGG - Exonic
1167134432 19:47608678-47608700 GGGCGGGGGCGGCGCCGGCGCGG + Intronic
1167145584 19:47679613-47679635 GGGCAGCGGCCGTGGCTGCGGGG + Exonic
1167157124 19:47745656-47745678 GCGCTGAGGCGGCGGCGGCGAGG + Exonic
1167578497 19:50328972-50328994 CGGCAGCGGTGGCGGCGGCGGGG + Exonic
1167643702 19:50695085-50695107 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1168073097 19:53963442-53963464 GAGCGGCGGGGGCTGCGGGGAGG - Intronic
1168073098 19:53963445-53963467 GGGGAGCGGCGGGGGCTGCGGGG - Intronic
1168076326 19:53982549-53982571 CGGCGGCGGCGGCGGCGCCGTGG + Exonic
1168076352 19:53982606-53982628 CGGCGGCGGAGGCGGCGGCGGGG + Exonic
1168247004 19:55117487-55117509 GGGCGGCGGCGGCGGCTGCCCGG - Exonic
1168315198 19:55482002-55482024 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1168332414 19:55578288-55578310 GAGAAGCGGCGCGGGCAGCGGGG + Exonic
1168339090 19:55613660-55613682 GAGCAGCGGCATCGGGGGCGAGG + Exonic
1168694423 19:58396604-58396626 CAGAGGCGGCGGGGGCGGCGGGG - Exonic
1202680328 1_KI270712v1_random:3199-3221 AAGGAGCGGCGGTGGCGGAGGGG + Intergenic
1202681312 1_KI270712v1_random:6733-6755 TAGAAGCCGCGGCGGCGGTGGGG + Intergenic
1202683791 1_KI270712v1_random:31146-31168 GAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1202693092 1_KI270712v1_random:105042-105064 GAGAGGCGGCGGCGGCGGAGAGG + Intergenic
1202693295 1_KI270712v1_random:105832-105854 GCGCAGCGGCGGCGCAGGCGCGG + Intergenic
924962169 2:45578-45600 GCACAGCGGCGGCGACGACGAGG - Exonic
925328720 2:3042269-3042291 GAGCAGCAGAGGCCGCGGCCGGG - Intergenic
925375377 2:3380069-3380091 GAGCAAGGGCCGCGGCGACGTGG - Intronic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
925730566 2:6917429-6917451 GAGAAGCGGCTGCGCGGGCGGGG - Exonic
926077219 2:9951334-9951356 GGGCGGCGGGGGCGGTGGCGGGG + Intergenic
926089877 2:10043198-10043220 GGGCGGCGGGGGCGGCGGGGCGG - Intronic
926089878 2:10043201-10043223 GCGGGGCGGCGGGGGCGGCGGGG - Intronic
926202635 2:10812721-10812743 CTGAAGCGGCGGCGGCGGTGGGG - Intronic
926217105 2:10912366-10912388 CAGCGGCGGCGGCGGCTGCAGGG + Exonic
926672927 2:15592104-15592126 GATCAGGGGCGGCCGCGGCTCGG + Intronic
927472268 2:23385399-23385421 CCGCAGCCGCGGCGGCCGCGGGG - Exonic
927881485 2:26692800-26692822 GGGCAGCAGCAGCGGCGGCCGGG + Exonic
927957388 2:27217357-27217379 CAGCAGAGACTGCGGCGGCGCGG - Intergenic
928303685 2:30147842-30147864 CGGCGGCGGCGGTGGCGGCGGGG - Intronic
928421113 2:31138375-31138397 CGGCAGCCGCGGTGGCGGCGTGG - Intronic
929133500 2:38602158-38602180 GCGCGGCGGCGGCGGCGGGGAGG - Intronic
929133501 2:38602161-38602183 GCGGCGCGGCGGCGGCGGCGGGG - Intronic
929242370 2:39665943-39665965 GCCCACCGGCGGCTGCGGCGGGG + Exonic
929261732 2:39873439-39873461 GAGCAGCAGCAGCGGCAGCAAGG - Intergenic
929604176 2:43224531-43224553 GAGGTGCGGCGGCCCCGGCGGGG + Exonic
929604187 2:43224565-43224587 GGGCGGCGCCGGCGGCTGCGCGG + Exonic
929701949 2:44169474-44169496 GCCCAGCGGAGGCGGCGGCCGGG - Intronic
930011421 2:46941034-46941056 CCGCGGCGGGGGCGGCGGCGGGG + Intronic
930872604 2:56184109-56184131 GAGCAGCCGGGGAGGCGCCGCGG + Exonic
931253509 2:60552425-60552447 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
931253851 2:60554149-60554171 GAGCGAGCGCGGCGGCGGCGGGG - Intergenic
931348871 2:61470930-61470952 GCGCCGAGGCGCCGGCGGCGGGG + Intergenic
931517832 2:63059941-63059963 GGGCAGCGGCGGCGGGAACGCGG + Intergenic
931681132 2:64750833-64750855 GAGCAGGGGCGGCCGCGGCGGGG + Intronic
931762499 2:65430907-65430929 CAGCAGCGGCGGCCGCCGCGCGG + Intronic
932496553 2:72148527-72148549 GAGCGGCGGGCGAGGCGGCGAGG + Intergenic
932567323 2:72918023-72918045 GGGCACTGGCGGCGGGGGCGCGG + Exonic
932800239 2:74735433-74735455 GATCAGTGGCGGGGGCGGTGGGG - Intergenic
933279957 2:80322562-80322584 GCGCGGCGGCGGAGGCCGCGGGG + Intronic
933666715 2:84970837-84970859 CGGCGGCGGCGGCGGCGGCCAGG + Intergenic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933666856 2:84971277-84971299 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
933684717 2:85133711-85133733 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
933772774 2:85754554-85754576 AGGCGGCGGCGGCGGCGGCGTGG - Exonic
933908291 2:86914936-86914958 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
933953273 2:87348727-87348749 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934189042 2:89768018-89768040 AAGCCGCGGCGGCGGGGGAGGGG + Intergenic
934237504 2:90245072-90245094 GCGCAGCGGCGGCGCAGGCGCGG - Intergenic
934248017 2:90324088-90324110 CCGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248176 2:90324661-90324683 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
934248189 2:90324702-90324724 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248362 2:90325312-90325334 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248373 2:90325350-90325372 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934248405 2:90325467-90325489 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
934261189 2:91478099-91478121 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
934296816 2:91749019-91749041 GGGCCGCGGCGGCGGCGGCGAGG - Intergenic
934459928 2:94208378-94208400 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
934467040 2:94272868-94272890 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
934467089 2:94273024-94273046 AAGCCGCGGCAGCGGGGGCGGGG + Intergenic
934467094 2:94273030-94273052 CGGCAGCGGGGGCGGGGGCGGGG + Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
934566977 2:95346598-95346620 GGGGCGCGGCGGCGGCGGCGCGG - Intronic
935196524 2:100819870-100819892 CAGCAGAGGCTGCGGCGGCCTGG + Intergenic
935592444 2:104855295-104855317 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
935592558 2:104855612-104855634 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
935592610 2:104855816-104855838 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
935592737 2:104856230-104856252 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592783 2:104856392-104856414 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
935592897 2:104857084-104857106 CGGCGGCGGCGGCGGCGGCAGGG - Exonic
936122700 2:109760441-109760463 GGGCGGCGGCGGCGGCGGCGCGG + Intergenic
936126703 2:109794590-109794612 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936221993 2:110611032-110611054 GGGCGGTGGCGGCGGCGGCGCGG - Intergenic
936389116 2:112055628-112055650 GGAAAGCAGCGGCGGCGGCGTGG - Exonic
936390783 2:112071310-112071332 GGGCAGTGGTGGCGGCGGCGGGG - Intronic
936412844 2:112275739-112275761 GAGCGGCAGCGCCGGCAGCGCGG + Exonic
936561417 2:113542248-113542270 GAGAGGGCGCGGCGGCGGCGCGG - Intergenic
936939640 2:117871067-117871089 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
937045146 2:118847177-118847199 GCGCGGCGGCCGGGGCGGCGGGG - Exonic
937128625 2:119490308-119490330 GAGCAGCGGAGGCAGCAGCATGG - Intronic
938018397 2:127885998-127886020 CGGCGGCGGCGGCGGCGGCCGGG + Intergenic
938038142 2:128053524-128053546 GAATTGGGGCGGCGGCGGCGGGG - Intergenic
938271855 2:129979678-129979700 GGGCTGCGGCGGCGGCGGCTGGG + Exonic
938406242 2:131034870-131034892 GGGCGGCGGCGGCGGCGGGCTGG - Intronic
938444146 2:131364122-131364144 GGGCTGCGGCGGCGGCGGCTGGG - Intergenic
938451542 2:131425324-131425346 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
938518338 2:132038446-132038468 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
939432660 2:142130786-142130808 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
939612934 2:144332295-144332317 CAGCAGCGGCGGCTGCGGCGCGG - Intronic
939969668 2:148644974-148644996 CAGCCCGGGCGGCGGCGGCGGGG - Exonic
940265135 2:151828362-151828384 GTGCCGCGGCGGCAGCGGCGGGG - Exonic
941119109 2:161507855-161507877 CCGCGGCGGCGGCGGCGGCGGGG - Intronic
941476181 2:165953898-165953920 GAGCAGGGGCGGCGGGGACCCGG + Intergenic
941580698 2:167293124-167293146 GACCGGCAGCGCCGGCGGCGCGG - Intergenic
941666458 2:168247624-168247646 AGGCAGCGCCGGCGGAGGCGGGG + Exonic
941906116 2:170716873-170716895 CAGCAGCGGCCGCAGAGGCGGGG - Exonic
941951452 2:171160697-171160719 GCGCGGCGGCGGAGGCGTCGAGG + Exonic
942046515 2:172102298-172102320 GGCGGGCGGCGGCGGCGGCGGGG - Exonic
942046550 2:172102427-172102449 GAGCGGCGGCGGCGCCGGCCCGG - Exonic
942303681 2:174586173-174586195 GAGCAGCAGCTGAGGCGGGGTGG + Intronic
942346219 2:175005266-175005288 CGGCGGCGGCGGCGGCGACGGGG + Intronic
942450900 2:176107586-176107608 CGGCGGCGGCGGCGGCAGCGCGG + Exonic
942450922 2:176107634-176107656 CGGCGGGGGCGGCGGCGGCGCGG + Exonic
942451048 2:176108072-176108094 AGGCAGCGGTGGCGACGGCGAGG + Exonic
942471919 2:176269475-176269497 CAGCAGCGGCGGCTGCAGTGAGG - Exonic
942674591 2:178413661-178413683 GAGCAACGAAGACGGCGGCGCGG - Intergenic
942748619 2:179264310-179264332 GAGCAGAGGCGGTGGCGGGGCGG + Intronic
942890520 2:180981092-180981114 GAGCCGCGGCGGGGCCGGCTGGG + Intronic
942970830 2:181956042-181956064 GGGCAGGGGTGGCGGCGGGGAGG - Intronic
944517401 2:200526184-200526206 GAGCAGCAGCGGCTGCGGCTTGG - Exonic
944582120 2:201140140-201140162 GGGCTGCGGCAGCGGCGGGGCGG + Intronic
945033022 2:205682632-205682654 GTGCGGCGGCGGTGGCGGCTGGG - Exonic
945431596 2:209771800-209771822 GAGCGGGTGCGGGGGCGGCGAGG + Intergenic
945466006 2:210171292-210171314 CGGCGGCGGCGGCGGCGGCCGGG - Exonic
945648936 2:212537138-212537160 CGGCGGCGGCGGCGGCGGAGCGG + Intronic
946159337 2:217826591-217826613 GAGCAGCGGAGGCAGCAGCAGGG - Intronic
946185537 2:217978676-217978698 GAGCGGGGGCGCCGGCGGGGCGG - Intronic
946219861 2:218217205-218217227 TGGCGGCGGCGGCGGCGGCTCGG + Exonic
946306585 2:218859920-218859942 GCGCAACGGCGGCGGCCGGGAGG - Exonic
946354000 2:219173438-219173460 GAGCAGCAGGGACGGTGGCGAGG - Exonic
946692489 2:222319771-222319793 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
946921427 2:224585155-224585177 GGGCAGCCGCGGCGGCGGCGGGG + Exonic
946921437 2:224585182-224585204 CGGCGGCGGCGGCGGCGGCTCGG + Exonic
947117945 2:226791675-226791697 GAGCCGCGGCGGGCGCGGGGCGG - Intronic
947506657 2:230713050-230713072 CCGCGGCGGCGGCGGCTGCGCGG - Exonic
947605777 2:231484178-231484200 GAGCAGAGGCGGCTGCAGTGTGG + Intergenic
947669170 2:231925871-231925893 GAGCGGCGAAGGCGGCCGCGTGG - Intronic
947840502 2:233204557-233204579 CAGCGGCGGCCGCGGCGTCGGGG - Exonic
948438128 2:237967396-237967418 TGACCGCGGCGGCGGCGGCGGGG + Intronic
948487238 2:238288710-238288732 GGGCGGCGGCGGCGGGCGCGGGG - Intronic
948645369 2:239400852-239400874 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
948801585 2:240435739-240435761 AGCCGGCGGCGGCGGCGGCGCGG - Exonic
948824681 2:240568504-240568526 GCCGGGCGGCGGCGGCGGCGGGG - Intronic
948824773 2:240568865-240568887 GCGTCTCGGCGGCGGCGGCGGGG - Exonic
948824796 2:240568924-240568946 GGGCAGCGGGGGCGGCGGCGCGG - Exonic
948880150 2:240852521-240852543 GAGGAGAGGCGGCCGCGGCAGGG - Intergenic
948945680 2:241217929-241217951 GCGCAGGGGCGGGGGCGGGGGGG + Intronic
949051933 2:241902325-241902347 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051940 2:241902342-241902364 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051947 2:241902359-241902381 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051954 2:241902376-241902398 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051961 2:241902393-241902415 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
949051968 2:241902410-241902432 GAGGGGAGGCGGCGGCGGAGGGG - Intronic
1168795884 20:610042-610064 GGCGGGCGGCGGCGGCGGCGCGG - Exonic
1168883252 20:1225636-1225658 CGGCGGCGGCGGCGGCGGCTGGG - Intergenic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1169278453 20:4248786-4248808 GGGCGGCGGCGGCGGCGTGGTGG - Exonic
1169278484 20:4248861-4248883 GGGCGGCGGCGGGGGCAGCGCGG - Exonic
1169849546 20:10034872-10034894 GAGGGGCGGAGGCGGAGGCGGGG + Intronic
1170150381 20:13221379-13221401 GGGCTGCGGGGTCGGCGGCGGGG - Intergenic
1170163956 20:13343575-13343597 GGGCGGGGGCGGGGGCGGCGGGG - Intergenic
1170190319 20:13638845-13638867 GCGCGGAGGCGGCAGCGGCGCGG + Intronic
1170756804 20:19212486-19212508 GCGGCGCGGCGGGGGCGGCGGGG - Intergenic
1171346526 20:24469895-24469917 GCGCAGACCCGGCGGCGGCGTGG + Intronic
1172015432 20:31870262-31870284 GGGCCGCGGCGGCCGGGGCGGGG + Intronic
1172028955 20:31968267-31968289 GGGAGGCGGCGGCGGCGGCCGGG + Exonic
1172037013 20:32018190-32018212 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172037028 20:32018213-32018235 GAGGGGCGGGGGCGGGGGCGGGG + Intronic
1172037337 20:32019235-32019257 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1172073657 20:32277705-32277727 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1172083217 20:32358678-32358700 GGGCGGCGGCGGCGGTGGGGGGG - Exonic
1172100891 20:32483564-32483586 CGGCAGCGGCGGCGGCGCCGCGG + Intronic
1172277230 20:33686292-33686314 GACAGGCGGCGGCGGCGGCGCGG + Exonic
1172474532 20:35226890-35226912 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1172596592 20:36154710-36154732 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
1172618721 20:36306448-36306470 GAGAGGCGGCGGCGGCGCAGCGG + Exonic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172698078 20:36835851-36835873 GAGCAGCGGCGGCGGCGGCGGGG - Intronic
1172883727 20:38217831-38217853 GGGGAGCGGGGGCGGGGGCGGGG - Intronic
1173221968 20:41138173-41138195 GAGTGGTGGCGGCGTCGGCGAGG + Intronic
1173251604 20:41366698-41366720 GACCAGCGGCGGGGGCGGCGCGG - Exonic
1173741655 20:45406391-45406413 GCGCACCGGCGTCGGTGGCGAGG + Intronic
1173800463 20:45891579-45891601 CAGGAACAGCGGCGGCGGCGCGG - Exonic
1173827581 20:46057563-46057585 GGTCCGCGGCGGCGGCCGCGAGG + Exonic
1174053915 20:47785433-47785455 CGGCAGCGGCAGCGGCGGCGCGG - Intronic
1174317524 20:49713915-49713937 CAGCGGCGGGGGCGGAGGCGGGG + Intergenic
1174357823 20:50010104-50010126 CAGCGGCGGCGGCGGCGGCGAGG + Intergenic
1174380716 20:50153740-50153762 GCGCGGCGGCGGCGCGGGCGGGG + Intergenic
1174386664 20:50191524-50191546 GGCGGGCGGCGGCGGCGGCGGGG - Exonic
1174607095 20:51768662-51768684 CTGCAGCGGTCGCGGCGGCGCGG - Intergenic
1175404300 20:58716808-58716830 GAGCAGGGGCGGCTGCAGCCGGG + Intronic
1175429372 20:58891237-58891259 CCGCGGCGGCGGCGGCGGCTGGG - Intronic
1175429534 20:58891705-58891727 TGGCGGCGGCGGCGGCGGCGGGG - Intronic
1175715516 20:61252449-61252471 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1175859715 20:62143656-62143678 GAGGCGCGGCGACGGCGACGGGG + Intergenic
1175901490 20:62361585-62361607 GGGCAGCGGCGGAGCCGGCTGGG + Intronic
1175975211 20:62707568-62707590 GAGCAGGGGAGGGGGCGGGGAGG + Intergenic
1176029798 20:63006476-63006498 GAGCAGCGGCGGCGGCGGCGCGG - Exonic
1176068922 20:63216016-63216038 GGGCGGCGGCGGCGGCTGCTGGG + Exonic
1176068951 20:63216134-63216156 CAGCGGCGACGGCGGCGGCAGGG + Exonic
1176128994 20:63488339-63488361 GAAGAGCGGCGGCGCCGGCAAGG - Exonic
1176157031 20:63627063-63627085 ATTCGGCGGCGGCGGCGGCGCGG + Intergenic
1176234839 20:64049393-64049415 GGGCGGCGGGGCCGGCGGCGAGG + Exonic
1176380752 21:6111193-6111215 GAGCAGCGCCAGCGGCCGAGCGG + Exonic
1176418971 21:6499175-6499197 CGGCAGCGGCGGCGGCGGGTGGG - Intergenic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548595 21:8212230-8212252 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176549734 21:8216030-8216052 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176556489 21:8256438-8256460 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176557625 21:8260259-8260281 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567526 21:8395265-8395287 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176568659 21:8399064-8399086 GGAGGGCGGCGGCGGCGGCGGGG + Intergenic
1176575428 21:8439480-8439502 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1176576572 21:8443299-8443321 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1176582861 21:8548622-8548644 AAGCCGCGAGGGCGGCGGCGGGG - Intergenic
1176583084 21:8549517-8549539 AAGCCGCGGCGTCGGGGGCGGGG - Intergenic
1176586596 21:8594673-8594695 AAGTCGCGGCGGCGGCGGGGGGG - Intergenic
1176591106 21:8651704-8651726 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1177014990 21:15775745-15775767 GTGCAGCGGGGGCGGGGGGGGGG - Intronic
1177166556 21:17611711-17611733 GAGCAGCCGCCGCGGTGACGAGG - Intronic
1177431693 21:20998277-20998299 GGGCGGCGGGGGCGGGGGCGCGG - Intergenic
1178487050 21:33025861-33025883 CGGCAGCGGTGGCGGGGGCGGGG - Intronic
1178493996 21:33071502-33071524 GAGCAGTGGCGGGGGCGGAGGGG + Exonic
1178992264 21:37366346-37366368 GGGCTGCGGGGGCGGCGGCGCGG + Intronic
1179561585 21:42219221-42219243 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1179663569 21:42893590-42893612 GGGCAGCGGCGGCGGCGGACCGG - Intronic
1179674888 21:42974681-42974703 CGGCGGCGGCGGCGGCGGAGCGG - Intronic
1179694464 21:43107497-43107519 CGGCAGCGGCGGCGGCGGGTGGG - Exonic
1179742720 21:43427047-43427069 GAGCAGCGCCAGCGGCCGAGCGG - Exonic
1179810168 21:43865145-43865167 AGGAAGTGGCGGCGGCGGCGCGG + Intergenic
1180064341 21:45405141-45405163 CAGCGGCGGCGGCTGCAGCGCGG + Intronic
1180101818 21:45590975-45590997 GAGAGGCGGAGGCGGGGGCGGGG + Intergenic
1180265692 22:10525669-10525691 AAGCCGCGAGGGCGGCGGCGGGG - Intergenic
1180269403 22:10571578-10571600 AAGTCGCGGCGGCGGCGGGGGGG - Intergenic
1180273934 22:10628737-10628759 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1180461975 22:15573289-15573311 GAGCTGTGGCGGCTGTGGCGAGG - Intergenic
1180534543 22:16386774-16386796 AAGCCGCGGCGGCGGGGGTGGGG - Intergenic
1180558345 22:16595515-16595537 GAGCAGGGTCTGCGTCGGCGTGG + Intergenic
1180914887 22:19479154-19479176 CGGCAGCGGCAGCGGCGGCTGGG - Exonic
1180942569 22:19668933-19668955 GAGCTGCGGTCGCGGGGGCGGGG + Intergenic
1180949414 22:19714469-19714491 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1180960668 22:19760998-19761020 GTAGCGCGGCGGCGGCGGCGGGG - Exonic
1180961933 22:19766177-19766199 GGGCGGCGGCGGCGGCGGGCGGG - Intronic
1181003272 22:19997930-19997952 GCGCAGTGGAGGCGGAGGCGGGG + Intronic
1181024042 22:20117623-20117645 GCGCGGCGGCGGCGGCGGCTCGG - Exonic
1181057843 22:20268293-20268315 GGGCGAGGGCGGCGGCGGCGCGG + Exonic
1181085122 22:20436386-20436408 ATGCAGCGGCGGCGGCGGGCGGG - Intronic
1181356268 22:22298069-22298091 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181356273 22:22298098-22298120 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181356280 22:22298127-22298149 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1181471344 22:23142036-23142058 CAGCAGCGTCCGCGGCGCCGCGG + Exonic
1181478025 22:23180573-23180595 CGGCGGCGGCGGCGGCGGCACGG + Exonic
1181710696 22:24685942-24685964 GTGCCGCGGCGGCAGCGTCGGGG + Intergenic
1181811306 22:25405236-25405258 CAGCAGCGGCCACGGCGGCCCGG + Intronic
1181902677 22:26169317-26169339 GAGGGGCCGCGGCGGCGCCGGGG - Intergenic
1182355360 22:29720295-29720317 GGGCGGCGGCGGCAGCGGCGAGG - Exonic
1182475519 22:30574588-30574610 CGGCAGCGGCGGCGGGGGCGGGG - Intergenic
1182475523 22:30574594-30574616 GCGGCGCGGCAGCGGCGGCGGGG - Intergenic
1183247219 22:36703246-36703268 CGGCGGCGGCGGCGGCGGCAGGG + Exonic
1183358932 22:37373464-37373486 CAGCGGCGGGGGCAGCGGCGGGG - Exonic
1183427210 22:37746315-37746337 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
1183441392 22:37825019-37825041 GCGCGGCGGCGGCCGAGGCGCGG + Exonic
1183466703 22:37983791-37983813 AGGCGGCGGCGGCGGCGGCCGGG - Exonic
1183524929 22:38317279-38317301 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1183702322 22:39457502-39457524 CAGCGGCGGCGGCGGCTCCGCGG - Exonic
1183912949 22:41092442-41092464 CCGGTGCGGCGGCGGCGGCGCGG + Exonic
1184153155 22:42649826-42649848 GAGCGGAGGCGCCGCCGGCGAGG - Intergenic
1184465898 22:44668775-44668797 TGGCAGCGGCGGCGGCGGCGCGG + Intronic
1184523804 22:45009872-45009894 AGGCGGCGGCGGCGGCGGCTGGG - Intronic
1184557392 22:45240745-45240767 GCTCGGGGGCGGCGGCGGCGGGG + Intronic
1184557424 22:45240893-45240915 GCGCGCGGGCGGCGGCGGCGCGG - Intergenic
1184620330 22:45671916-45671938 CTGCAGCGGCGGCGGCGGTTAGG + Exonic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1184759601 22:46537150-46537172 GGGCGGCGGCGGCGGCGCCATGG + Exonic
1184767031 22:46577395-46577417 GGGCGGCGGCGGCGGCGGCGGGG - Intronic
1185055202 22:48575677-48575699 CGGCCGCGGCGGCGGAGGCGCGG + Intronic
1185055269 22:48575874-48575896 CGGCGGTGGCGGCGGCGGCGCGG + Intronic
1185272516 22:49935654-49935676 GAGCAGGGGCGGGGACGGAGGGG + Intergenic
1185272620 22:49935893-49935915 GAGCAGGGGTGGGGGCGGAGGGG + Intergenic
1185278857 22:49961380-49961402 CACGGGCGGCGGCGGCGGCGGGG + Intronic
1185296700 22:50058282-50058304 GTGCAGCGGCGGCGGCCCCGGGG + Intergenic
1185335163 22:50268070-50268092 GAGCTGGGGCGGCGGGGCCGGGG - Intronic
1185409435 22:50674426-50674448 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1185420264 22:50731023-50731045 GGGCAGCGGCGACGGCGAGGGGG - Intergenic
1203253479 22_KI270733v1_random:128535-128557 CCGCGGCGTCGGCGGCGGCGCGG - Intergenic
1203254622 22_KI270733v1_random:132357-132379 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203261533 22_KI270733v1_random:173613-173635 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203262678 22_KI270733v1_random:177436-177458 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
950040272 3:9915554-9915576 GAGCAGCAGCAGCGGGCGCGGGG - Exonic
950215277 3:11154465-11154487 GGGCGGCGGCGGGGGCGCCGGGG - Intronic
950215281 3:11154474-11154496 GTGTCGCGGGGGCGGCGGCGGGG - Intronic
950345379 3:12288001-12288023 GACCTGCGGCCACGGCGGCGTGG - Intronic
950438284 3:12993450-12993472 CAGCAGCGGTGGTGGAGGCGGGG + Intronic
950487782 3:13283023-13283045 GCGGCGGGGCGGCGGCGGCGCGG + Intergenic
950902998 3:16513710-16513732 GACGCGCGGCGGCGGCGGCGGGG - Intronic
951080464 3:18445285-18445307 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
951543609 3:23806045-23806067 CAGCAGCCGCCGCGGCGGCACGG + Exonic
951898384 3:27632901-27632923 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951898388 3:27632918-27632940 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951898392 3:27632935-27632957 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951898396 3:27632952-27632974 GCGCGGAGGCAGCGGCGGCGCGG - Intergenic
951907803 3:27721610-27721632 CAGCGGCGGGGGCGGCGGCCCGG - Exonic
953055337 3:39383465-39383487 GAGCCGCGGAGTCTGCGGCGCGG + Exonic
953947779 3:47164026-47164048 CGGCGGCGGCGGCGGCGGCAGGG + Intergenic
953989879 3:47475828-47475850 CGGCGGCGGCGGCGGCGACGGGG + Exonic
954004223 3:47578875-47578897 CAGCGGCGGCAGCGGCGGCGCGG - Exonic
954194919 3:48990688-48990710 GAGCAGCGCCGGGGGCAGCGTGG - Intronic
954223082 3:49166295-49166317 GAGCAGCGGAGGCGGCGCAGAGG - Exonic
954265936 3:49470365-49470387 GAGCGGCGGTGGCGGCGTCCTGG + Exonic
954367598 3:50154832-50154854 GCGAAGCGGGGGCGGGGGCGAGG + Intergenic
954437423 3:50503467-50503489 CGGCGGCGGCGGCGGCGGCGGGG + Intronic
954540633 3:51391266-51391288 GCGCGGCGGTGGCGGCGGGGCGG - Exonic
954615555 3:51967344-51967366 CGGCGGCGGCGGCGGCGGCACGG + Exonic
954778998 3:53045744-53045766 GGGCGGCGGCGGCGCCGGGGCGG - Intronic
954778999 3:53045747-53045769 GAGGGGCGGCGGCGGCGCCGGGG - Intronic
954795931 3:53161381-53161403 GGGTCGCGGCGGCAGCGGCGGGG - Exonic
955769232 3:62372517-62372539 TGGCGGCGGCGGCGGCGGGGGGG - Exonic
955769235 3:62372520-62372542 CGGTGGCGGCGGCGGCGGCGGGG - Exonic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
955911570 3:63863949-63863971 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
955916488 3:63912663-63912685 GAGCAGCGGCCGCGGCCGCCCGG + Exonic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956675022 3:71725289-71725311 CGGCGGCAGCGGCGGCGGCGCGG + Exonic
956678144 3:71754070-71754092 GGGTGGCAGCGGCGGCGGCGAGG + Exonic
956678145 3:71754073-71754095 TGGCAGCGGCGGCGGCGAGGCGG + Exonic
956818309 3:72929006-72929028 GAGAGGCGGCGGTGGCTGCGCGG - Intronic
958942919 3:100334854-100334876 GAGCGGCGCCGGCGGTGGCTCGG + Intronic
959849759 3:111072115-111072137 CAGCAGCGGAGGTGGCGTCGGGG - Exonic
961202487 3:125055852-125055874 GAGCGGCGGCGGCCACCGCGAGG + Exonic
961545326 3:127629239-127629261 AAGCAGCGGCGGCAGCCGGGCGG - Exonic
961650744 3:128415632-128415654 GAGCATGGGCCCCGGCGGCGAGG - Intergenic
961735932 3:129002163-129002185 GGCGGGCGGCGGCGGCGGCGCGG - Exonic
961816996 3:129556186-129556208 GAGCAGAGACGGCTGGGGCGGGG - Exonic
961827164 3:129605277-129605299 CGGCGGCGGCGGCGGGGGCGGGG - Intronic
961827168 3:129605283-129605305 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962277955 3:134030037-134030059 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
962301863 3:134250565-134250587 CAGCAGCGGCGGCGGCGGCGGGG + Exonic
962575526 3:136752164-136752186 GGGCGGCGGCGACGGCGGCGGGG - Intronic
962808890 3:138945757-138945779 GAGCTGGCCCGGCGGCGGCGCGG + Exonic
962919139 3:139935428-139935450 GAGCGGCAGCGGCGGTGGCGGGG + Exonic
963038380 3:141051396-141051418 GGGCGGCGGCGGCGGAGGAGGGG + Exonic
963236727 3:142963620-142963642 CTGCGGCAGCGGCGGCGGCGCGG + Exonic
963253044 3:143119853-143119875 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
963870192 3:150408301-150408323 CGGCAGCGGCGGCGGCAGCGGGG + Intergenic
963904456 3:150762660-150762682 GGGCCCCGGCGGCGGCGGCGGGG - Exonic
964482779 3:157159572-157159594 CAGCGGCGGCGGCGGCGGGAGGG - Intronic
964720620 3:159764763-159764785 GACCCGCAGCGGCGGCGGCGGGG + Exonic
964771284 3:160226109-160226131 GGACAGTGGCGGCGGCGGCCGGG + Exonic
965520372 3:169663796-169663818 GAGCCGCGGGGAGGGCGGCGGGG + Intergenic
965757228 3:172039667-172039689 GAGCAGCGAAGGGGGCGGCAGGG + Intronic
965881762 3:173396063-173396085 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
966182080 3:177197186-177197208 AGGCGGTGGCGGCGGCGGCGAGG - Intronic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966866519 3:184261473-184261495 CGGCGGCGGCGGCGGTGGCGGGG + Intronic
966878293 3:184335949-184335971 GGGGAGCGGCGGCGGACGCGCGG + Intronic
966886511 3:184380335-184380357 GAGCAGCAGCGGGGCCGGCGGGG - Exonic
967033720 3:185631609-185631631 GAGCAGGGGCTGCGGGGGGGGGG - Exonic
967272635 3:187743799-187743821 AAGGCGCGGCGGCGGCGGCCCGG - Intronic
967916720 3:194583896-194583918 CGGCGGCGGCTGCGGCGGCGGGG + Intergenic
967930636 3:194687833-194687855 CAGCAGCAGAGGCGGCGGCCCGG - Exonic
968178187 3:196569035-196569057 TAGCGGCGGCGGCGCGGGCGCGG + Exonic
968434110 4:576196-576218 GGGCTCCGGCGGCGGCGGCGCGG - Intergenic
968479131 4:826113-826135 GAGCTGCGGCGGCGGCTGAAGGG + Exonic
968556737 4:1249488-1249510 GGGCGGCTGCGGCTGCGGCGCGG - Intronic
968640501 4:1712222-1712244 AGGCTGAGGCGGCGGCGGCGCGG + Exonic
968659508 4:1793296-1793318 GCGCGGTGGCGGCGGCGTCGCGG + Exonic
968659644 4:1793714-1793736 GGGCGGCGGCGGCGGCGGGCGGG + Intronic
968674386 4:1870138-1870160 GGACAGCAGCGGAGGCGGCGCGG + Intergenic
968688751 4:1978859-1978881 GGGAAGAGGCGGCGGCGGAGGGG + Exonic
968728850 4:2260532-2260554 GAGAAGCGGCAGCGGGGGCCGGG + Intronic
968775435 4:2536963-2536985 GCGGGGCGGCGGCGGCGGCTCGG + Intronic
968835789 4:2963574-2963596 GTGCCCCGGCCGCGGCGGCGAGG + Intergenic
968850487 4:3074615-3074637 GGGCCGCGCCGGCGGAGGCGGGG - Intergenic
968850579 4:3075028-3075050 TGGCGGCGGGGGCGGCGGCGGGG - Exonic
969330801 4:6472541-6472563 TGGCTGCGGCGACGGCGGCGAGG + Intronic
969357752 4:6640550-6640572 AGGCACCGGCGGCGGCGTCGCGG - Exonic
969436591 4:7192612-7192634 CGGCAGCGGAGCCGGCGGCGGGG - Exonic
969715851 4:8867786-8867808 GAGCAGCGGTGGGGGCGGCGCGG + Exonic
969715873 4:8867848-8867870 GCCCAGCGGCGGCTGCGGCCGGG + Exonic
970194637 4:13542442-13542464 GTGCAGCGGGGCCGGCGGCGGGG - Exonic
970333012 4:15003723-15003745 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
970333016 4:15003729-15003751 CGGCGGCGGCGGCGGGGGCGGGG + Exonic
970333032 4:15003782-15003804 GGGCAGCGGCGGCGGCGACGCGG - Exonic
970456221 4:16226550-16226572 CGGCGGCGGCGGCGGCGGCTCGG - Intronic
971018946 4:22515673-22515695 CGGCGGCGGCGGCGGCGCCGCGG - Exonic
971279798 4:25233913-25233935 CGGCGGCGGCGGCGGCAGCGGGG - Intronic
971406031 4:26321258-26321280 GGGCGGCGGCGGCGGCGGCGAGG + Intronic
971457807 4:26860791-26860813 GCGCCGCGGCGGCGGCGGCGCGG + Intronic
972265338 4:37454004-37454026 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
972765828 4:42151849-42151871 ACGAAGCGGCGGCGGCGGCCCGG + Exonic
972765862 4:42151958-42151980 GAAGGGCGGCGGGGGCGGCGGGG + Exonic
973137315 4:46724423-46724445 GGGCCGCGGCGGCGGCGGCAGGG + Intergenic
973279219 4:48341712-48341734 CGGAGGCGGCGGCGGCGGCGGGG + Exonic
973635944 4:52862208-52862230 GCGGAGCGGCGCCGGGGGCGGGG + Intergenic
973820589 4:54658632-54658654 GAGCAGAGGCGGCAGCGGGTCGG - Intronic
974047140 4:56907872-56907894 CGGTGGCGGCGGCGGCGGCGCGG + Intronic
975701916 4:77075447-77075469 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
975778966 4:77819619-77819641 CGGCGGCGGCGGCGGCGACGGGG + Intergenic
975778985 4:77819675-77819697 CGGCGGCGGCGGTGGCGGCGGGG + Intergenic
975779023 4:77819793-77819815 GAACGGCAGAGGCGGCGGCGCGG + Intergenic
975870773 4:78776360-78776382 GAGCCGCGGAGCGGGCGGCGGGG + Exonic
975870831 4:78776576-78776598 GGGCGGCAGCGGCGGCGGAGCGG + Exonic
975986259 4:80203237-80203259 CGGCTGCGGCGGCGGCCGCGGGG + Exonic
976246470 4:83010793-83010815 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
976297250 4:83484870-83484892 GAGGAGGCGCGGCGGCGTCGGGG + Intronic
976431407 4:84966514-84966536 AGGCTGAGGCGGCGGCGGCGGGG - Intergenic
977257549 4:94757921-94757943 CGGCGGCGGCGGCGGCGGAGCGG + Intergenic
977257651 4:94758272-94758294 GTGGGGCGGTGGCGGCGGCGGGG + Intronic
977257652 4:94758275-94758297 GGGCGGTGGCGGCGGCGGGGAGG + Intronic
977257685 4:94758383-94758405 GGGCAGCGGCGGCGGCGGGCGGG + Intronic
977810066 4:101347530-101347552 CGGCGGCGGCGGCGGCGGAGGGG - Intronic
978072572 4:104491421-104491443 CGGCGGCGGCGGCGGAGGCGGGG - Exonic
978072585 4:104491454-104491476 GGGCGGGGGCGGCGGCGGGGGGG - Exonic
978366653 4:107989906-107989928 TGGCAGCGGCGGCGACAGCGAGG - Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978617929 4:110614363-110614385 GAGTCCCGGCGACGGCGGCGGGG + Intergenic
978749620 4:112232063-112232085 GAGGAGCGGCGGCGCCTGGGCGG + Exonic
980130451 4:128811909-128811931 TGGGAGCGGCAGCGGCGGCGAGG - Intronic
980827380 4:138089051-138089073 GAGGAGCGGCGGCAACGGCGCGG - Intergenic
981429891 4:144646242-144646264 AAACGGCGACGGCGGCGGCGGGG - Exonic
981615458 4:146639371-146639393 CAGCAGCGGCGGCGGGGGCTCGG + Exonic
982042367 4:151409032-151409054 GGCCGGCGGCGGCGGGGGCGGGG + Intergenic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982288804 4:153759970-153759992 GATCTGCGGCGGCGGCGGAGCGG + Exonic
982712204 4:158768942-158768964 CCACGGCGGCGGCGGCGGCGCGG - Intergenic
982712249 4:158769128-158769150 GGGCGGCGGCCGCGGTGGCGGGG - Exonic
982712276 4:158769194-158769216 GAGCTGCGGCGGCGGCATCATGG + Exonic
982745823 4:159103435-159103457 AGGCGGCGGCGGCGGCGGCTGGG + Intergenic
982745993 4:159104020-159104042 AAACCGCGGCGGCGGCGGCGCGG - Intergenic
983577006 4:169271016-169271038 GGGAGGCGGCGGCGGCGGCGTGG - Exonic
983904383 4:173169032-173169054 GAGCAGGGGCGGCGGGGTCGCGG + Intronic
983904437 4:173169212-173169234 GAGCCGCTGCCGCGGCAGCGCGG - Intronic
983940283 4:173529553-173529575 AGGCGGCGGCGGCGGCGGCCAGG - Exonic
984668066 4:182449093-182449115 CGGCGGCGGCGGCGGCGGCCTGG + Intronic
984928367 4:184826037-184826059 GCTCAGCCGCGGCGGTGGCGGGG - Intronic
984973434 4:185209954-185209976 CAGCAGCAGCGGCGGCGCCGGGG + Intronic
985068384 4:186144813-186144835 GAGGGGAGGCGGCGCCGGCGCGG + Intronic
985515875 5:344257-344279 CGGCAGAGGCGGAGGCGGCGGGG + Intronic
985629986 5:1009168-1009190 GGGCGGCGGCGGCTGCGGCACGG - Exonic
985894267 5:2739622-2739644 GTCCGGCGGCGACGGCGGCGGGG - Intergenic
985896298 5:2751567-2751589 GGGCCGGGGCGGCGGCGGGGTGG + Exonic
986152487 5:5140282-5140304 GAGTGGCAGCCGCGGCGGCGGGG - Intergenic
986297088 5:6448739-6448761 CGGCGGCGGCGGCTGCGGCGGGG + Exonic
986608624 5:9546177-9546199 GCGGCGCGGCGGCGGGGGCGGGG - Intergenic
986813662 5:11385167-11385189 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
987050402 5:14143562-14143584 GGGGGGCGGCGGCGGCGGCTCGG - Intergenic
987087978 5:14487507-14487529 CGGCGGCGGCGGCGGCAGCGGGG + Exonic
987087983 5:14487519-14487541 CGGCAGCGGGGGCAGCGGCGGGG + Exonic
987193240 5:15500349-15500371 GGGACCCGGCGGCGGCGGCGCGG + Exonic
987258268 5:16179474-16179496 CGGCGTCGGCGGCGGCGGCGGGG + Exonic
988564834 5:32312706-32312728 GGGCAGGGGCGGCCGGGGCGAGG - Intronic
988609540 5:32711863-32711885 TGGCGGCGGCGGCGGTGGCGCGG + Exonic
989812570 5:45695868-45695890 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990210546 5:53478919-53478941 GTGCAGGTGCGGCGGCCGCGGGG + Intergenic
990825486 5:59893553-59893575 GGGCAGCGACAGCGCCGGCGGGG - Exonic
990955028 5:61332326-61332348 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
990955035 5:61332353-61332375 CAGCGGCGGCGGCGGCGGCGCGG + Exonic
990955102 5:61332653-61332675 CAACACCGGCGGCGGCGCCGCGG + Exonic
990955116 5:61332692-61332714 CAGCGGTGGCGGCGGCGGCGCGG + Exonic
991900533 5:71455710-71455732 GAGAGGAGGAGGCGGCGGCGGGG + Exonic
992067298 5:73120170-73120192 GAGCGGCGGCGTGGGGGGCGCGG - Intergenic
992105588 5:73447415-73447437 GTGCGGTGGCGGGGGCGGCGGGG + Exonic
992105723 5:73448035-73448057 GGGCGGCGGCGGCGGCGGCGCGG - Exonic
992105826 5:73448367-73448389 GTGGCGCGGCGGCGGCGGGGCGG + Intergenic
992530143 5:77645318-77645340 CGGCGACGGCGGCGGCGGCGCGG - Intergenic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994067115 5:95555452-95555474 CAGCACAGGCGGCGGCGGTGAGG - Intronic
994072824 5:95620838-95620860 CGGCGGCGGCGGCAGCGGCGAGG - Exonic
994353394 5:98770460-98770482 GAGCAGCGGCGGAGCCCGCAGGG + Intronic
995106233 5:108381004-108381026 CGGCGGCGGCGGCGGTGGCGGGG - Exonic
995388310 5:111612248-111612270 GAGGAGGGGCGGGGGCGGGGTGG + Intergenic
995574309 5:113513634-113513656 GCGCAGCGGCGGCCGCGCTGAGG + Intergenic
996948193 5:129094802-129094824 CAACAGCGGCGCCGGGGGCGCGG + Exonic
997201314 5:132011640-132011662 CGGCAGCGGCGGCGGCGGCGCGG - Exonic
997302938 5:132819717-132819739 GAGCTGGGGAGGCGGCCGCGGGG + Intergenic
997560976 5:134846058-134846080 AGGCAGCGAGGGCGGCGGCGAGG - Exonic
997652888 5:135535464-135535486 CAGGAGAGGCGGCGGCGCCGCGG - Exonic
998166673 5:139848286-139848308 GCGCGGCCGCGGCGGCGGCGGGG + Exonic
998200488 5:140114307-140114329 CAGTGGCGGCGGCGGCGGCGGGG + Exonic
998583558 5:143403957-143403979 GGGTGGCGGCGGCAGCGGCGGGG + Intronic
999140462 5:149358110-149358132 CGCCAGCAGCGGCGGCGGCGAGG - Exonic
999300239 5:150486234-150486256 AGGAGGCGGCGGCGGCGGCGTGG + Intronic
1000220187 5:159208223-159208245 GCCCCGCGGCGGCGGCGGCCCGG - Intronic
1001035089 5:168291775-168291797 CGGCAGCGGCAGCGGCGGCGTGG + Intronic
1001065073 5:168529582-168529604 CCGAGGCGGCGGCGGCGGCGCGG + Exonic
1001065119 5:168529699-168529721 GCGCGGCGGCGGCGACGGCAAGG + Exonic
1001639134 5:173232899-173232921 GGCAGGCGGCGGCGGCGGCGGGG + Exonic
1001906597 5:175478609-175478631 GAGCAGCGCGGGCGGCAGCCCGG + Exonic
1001984287 5:176060902-176060924 GAGCAGCGGTGGGGGCGGGTGGG + Intronic
1002233189 5:177783163-177783185 GAGCAGCGGTGGGGGCGGGTGGG - Intronic
1002262790 5:178006618-178006640 GAGCAGCGGTGGGGGCGGGTGGG + Intronic
1002291848 5:178205369-178205391 GGGCCGCGCCGGCGGCTGCGTGG + Intronic
1002524237 5:179806663-179806685 AGGCGGCGGCGGCGGCGGCAGGG + Intronic
1002559445 5:180071706-180071728 GAGCAGCGGCGGCTGCCGGAGGG - Exonic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002591068 5:180291969-180291991 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1002621973 5:180494461-180494483 TGGCGGCGGCGACGGCGGCGCGG + Exonic
1002771276 6:292448-292470 GAGGAGCGGCGGGGCGGGCGGGG - Exonic
1002788869 6:424257-424279 CAGCAGCGCCCGCGGCGGCCTGG - Intergenic
1002897996 6:1390169-1390191 GAGCGCGGGCGGCGGCGGCGCGG + Exonic
1002926549 6:1608973-1608995 GATCAGAGGGGGCGGCGGCGCGG + Intergenic
1002927000 6:1610525-1610547 GCGCGGCGGCCGCGGCGGCCGGG + Exonic
1002927148 6:1611183-1611205 GGGCAGCGGCAGCGCCGCCGCGG + Exonic
1002927176 6:1611314-1611336 GGGCGCGGGCGGCGGCGGCGCGG - Exonic
1002927244 6:1611567-1611589 GGGCGGCGGCGGCGGCGGCGCGG + Exonic
1002927308 6:1611786-1611808 CGGCGGCGGCGGCGGCGGCGGGG + Exonic
1003123239 6:3335266-3335288 CAGCAGCGGCGGAGGCTCCGAGG + Intronic
1003995811 6:11538216-11538238 GGGCGGCGGCGGCGGCTGCGAGG - Intergenic
1004199611 6:13535653-13535675 GTGCAGGGGCGGCGGGGGCAGGG - Intergenic
1004216774 6:13711233-13711255 GGGAGGCGGGGGCGGCGGCGGGG + Exonic
1004216779 6:13711242-13711264 GGGCGGCGGCGGGGGCGGCGGGG + Exonic
1004272928 6:14211274-14211296 GGGCATCGGCGGCAGCGGCGCGG - Intergenic
1004504728 6:16238654-16238676 CTGCGGCGGCGGCGACGGCGGGG - Exonic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1004864334 6:19838152-19838174 GAGCGGGGTCCGCGGCGGCGCGG - Exonic
1004924337 6:20403326-20403348 TGGCAGCGGCGGCGCCCGCGTGG + Intronic
1005267359 6:24126158-24126180 CGGCGGCGGCGGCGGCTGCGCGG + Intronic
1005327891 6:24720279-24720301 CGGAAGAGGCGGCGGCGGCGGGG + Exonic
1006337431 6:33427987-33428009 GCGCGGTGGGGGCGGCGGCGGGG - Intronic
1006340468 6:33443717-33443739 GGGCAGCGGTGGGGGTGGCGGGG + Exonic
1006458269 6:34144176-34144198 CAGCAGCATCGGCGGCGGCAGGG - Intronic
1006472663 6:34237336-34237358 CCGCGGCGGCGGCGGCGGAGGGG + Intronic
1006725499 6:36196789-36196811 CGGGAGCGGCGGCGGCGGCCGGG + Exonic
1006860889 6:37170822-37170844 GGGCAGCGGCGGCTTCGGCTCGG + Exonic
1006950813 6:37819895-37819917 CGGCAGCGGTGGCGGCGGCTGGG - Exonic
1006981719 6:38153133-38153155 GACCAGAGCCGGCGGAGGCGGGG - Exonic
1007032370 6:38639906-38639928 CAGCAGCCGGGGCGGCGGCGAGG - Exonic
1007781401 6:44256973-44256995 GAGCTGCAGCGGAGGGGGCGGGG - Intronic
1007902046 6:45422031-45422053 CCGCCGCGGAGGCGGCGGCGCGG + Intronic
1008027352 6:46653120-46653142 GGGAAGCGGCCGCCGCGGCGCGG + Exonic
1008520901 6:52362003-52362025 TCGCAGCGGCGGCAGCGGCGCGG + Intronic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1010569965 6:77464126-77464148 GGGTGGCGGTGGCGGCGGCGCGG - Intergenic
1010781066 6:79947036-79947058 GATCAGCGGAGGGGCCGGCGCGG - Intronic
1011128739 6:84033710-84033732 GACCCGCAGCGGAGGCGGCGCGG - Intergenic
1011194007 6:84763998-84764020 CTGCAGCCGCGGCGGCGGCGCGG - Exonic
1011277309 6:85643382-85643404 GAGGAGCGGGGAAGGCGGCGCGG - Intronic
1011607372 6:89118087-89118109 GGGCGGGGGCGGCGCCGGCGCGG + Intergenic
1012399995 6:98835068-98835090 GTCCCACGGCGGCGGCGGCGGGG + Exonic
1012400008 6:98835089-98835111 GGGCGGTGGCGGCGGCGGGGGGG + Exonic
1012400018 6:98835107-98835129 GGGGGGCGGGGGCGGCGGCGGGG + Exonic
1013099482 6:106974874-106974896 TGGCAGTGGCGGCGGCGGCGGGG - Intronic
1013117470 6:107114444-107114466 GGCCCGCGGCGGCGGCGGCCGGG - Intronic
1013117563 6:107114734-107114756 GGCGGGCGGCGGCGGCGGCGCGG + Intronic
1013472411 6:110476829-110476851 GAGCGGCGGCGCTGGGGGCGAGG - Intergenic
1013836605 6:114342429-114342451 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1014137625 6:117907484-117907506 GGGCGGCGGCGGCGGCGGCACGG + Intergenic
1014246896 6:119078799-119078821 CGGCGGCGGCGGCGGCTGCGCGG - Intronic
1014798314 6:125749653-125749675 GCGCGGCTCCGGCGGCGGCGCGG - Exonic
1014947564 6:127515978-127516000 GAGGGGCGGCAGCGGCGGGGAGG - Exonic
1015220639 6:130801497-130801519 CGGCAGCGGCGGCAGCGGCGGGG + Intergenic
1015965589 6:138693082-138693104 CGGCGGCGGCCGCGGCGGCGAGG + Intergenic
1016034547 6:139373383-139373405 CAGCAGCTCGGGCGGCGGCGCGG - Exonic
1016330092 6:142945919-142945941 GAGCGGCCGCCGCGGCTGCGAGG - Intergenic
1016378718 6:143450808-143450830 GAGCGGCGGCGGCTGCGCGGCGG + Intronic
1016447761 6:144150516-144150538 CAGATGCGGCCGCGGCGGCGCGG + Exonic
1016982311 6:149864353-149864375 GAACAGTGGCCGCGGCGGGGTGG + Intergenic
1017146686 6:151240909-151240931 GAGCAGCGGCGAGCGCGGCGGGG + Intronic
1017164139 6:151391487-151391509 CAGAGGCGGCGGCGGCGGGGAGG - Exonic
1017164140 6:151391490-151391512 AGGCAGAGGCGGCGGCGGCGGGG - Exonic
1017164162 6:151391559-151391581 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1017671968 6:156777703-156777725 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1017793703 6:157823303-157823325 GAGGAGCGGCCGCCGCGCCGGGG + Exonic
1018023933 6:159789549-159789571 CAGCAGTGGCTGCGACGGCGTGG + Exonic
1018400326 6:163414600-163414622 CGGCAGCAGCGGCGGCGGCGGGG - Intronic
1018613154 6:165662532-165662554 GCGCGGCGGCGGCTGCGGCTGGG - Intronic
1018613394 6:165663259-165663281 CGGCGGCGGCGGCGGCGGCGTGG - Intronic
1018669615 6:166167885-166167907 GAGCCGCGGCGGCAGCGCTGGGG + Intronic
1018707085 6:166470974-166470996 GGGCAGTGGCGGCGGTGGCTGGG + Intronic
1019111906 6:169723945-169723967 CGACGGCGGCGGCGGCGGCGCGG - Exonic
1019111916 6:169723980-169724002 CGGCAGCGGCGGCGGCGGCCGGG - Exonic
1019298498 7:291162-291184 CGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1019505425 7:1388136-1388158 GAGCAGGCGCGGCGGCGGGCGGG + Intergenic
1019537834 7:1538250-1538272 GGACGGCGGGGGCGGCGGCGGGG + Intronic
1019711490 7:2520034-2520056 GGGCGGCGGCGGCGGCGCCCGGG + Exonic
1019828333 7:3301616-3301638 CGGTGGCGGCGGCGGCGGCGCGG + Exonic
1019989613 7:4682457-4682479 TGGCGGCGGCGGCGGCGGCCCGG - Exonic
1020037604 7:4974243-4974265 GAGCTGCGGGGGTGGGGGCGGGG + Intergenic
1020238466 7:6374467-6374489 TGGGAGCGGCGGCGCCGGCGCGG + Intergenic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020238525 7:6374699-6374721 GGGCCGCGGCGGCGGCGGCAGGG - Exonic
1020274293 7:6615498-6615520 CGACGGCGGCGGCGGCGGCGGGG + Intergenic
1020278310 7:6637517-6637539 CGGGGGCGGCGGCGGCGGCGGGG + Intronic
1021313150 7:19117060-19117082 CTGTGGCGGCGGCGGCGGCGCGG - Exonic
1021313185 7:19117171-19117193 GCGCAGCGCGGGCGGCGGCGCGG - Exonic
1021451051 7:20784421-20784443 CGGCGGCGGCGGCGGCGGCTCGG - Exonic
1021451251 7:20785336-20785358 GGGCAGCGGCGGCGGCGGCGGGG - Exonic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1021827987 7:24573550-24573572 GAGCGGCGGCAGCGGCGGCGCGG + Exonic
1021828053 7:24573757-24573779 AGGCGGCGGCGGCGGCGCCGCGG + Intronic
1022101918 7:27174003-27174025 GGGCAGCGGTGGCGGTGGCGGGG - Exonic
1022106288 7:27199922-27199944 CTGCAGCGGCGGCGGCTGCCGGG - Exonic
1022113513 7:27245103-27245125 GAGCAACGGCGGCAGTGGTGGGG + Exonic
1022383872 7:29884363-29884385 GGGGAGCGGGGGCGGCGGGGCGG - Exonic
1022715147 7:32891883-32891905 GGGCGGGGGCGGGGGCGGCGGGG - Exonic
1022715152 7:32891892-32891914 GCGCGGCGGGGGCGGGGGCGGGG - Exonic
1022723026 7:32957596-32957618 CAGGAGCAGCGGTGGCGGCGGGG - Exonic
1023405882 7:39833523-39833545 CGGTAGCGGCGGCGGCGGCGAGG + Intergenic
1023418121 7:39950739-39950761 CAGCAGCGGCGGCTGCTGAGGGG - Exonic
1023703055 7:42911767-42911789 GAGCCGCGGCGCTGGCGGTGGGG - Intronic
1023875830 7:44285818-44285840 GAGGCGCGGCGGAGGGGGCGCGG + Intronic
1023951278 7:44848025-44848047 CGAGAGCGGCGGCGGCGGCGCGG - Exonic
1023967016 7:44967984-44968006 GAGCAGGGGCGGGGGCTGCCAGG + Intronic
1024043863 7:45574567-45574589 AGGCGGCGGCGGAGGCGGCGCGG + Exonic
1024639365 7:51316884-51316906 GAGCAGCCGGGGCGGGGGCGCGG - Intergenic
1024947574 7:54825729-54825751 AAGCAGCAGCGGAGGCTGCGTGG - Intergenic
1025561823 7:62380069-62380091 AAAAAGCCGCGGCGGCGGCGGGG - Intergenic
1026765164 7:73155455-73155477 AAGCGGCGGCGGGGGCGGGGCGG - Intergenic
1026765165 7:73155458-73155480 GCGAAGCGGCGGCGGGGGCGGGG - Intergenic
1026806739 7:73433803-73433825 TGGCAGCGGCGGTGGCGGCTAGG + Exonic
1026853479 7:73738659-73738681 CAGCAGCAGCGGCGGCCGAGGGG - Exonic
1026923759 7:74174607-74174629 GAGACGGGGCGGCGGCGGCTGGG + Intronic
1027041637 7:74965210-74965232 AAGCGGCGGCGGGGGCGGGGCGG - Intronic
1027041638 7:74965213-74965235 GCGAAGCGGCGGCGGGGGCGGGG - Intronic
1027082004 7:75237156-75237178 GCGAAGCGGCGGCGGGGGCGGGG + Intergenic
1027082005 7:75237159-75237181 AAGCGGCGGCGGGGGCGGGGCGG + Intergenic
1027228594 7:76260034-76260056 GGTCAGCGGCCGCCGCGGCGGGG + Exonic
1027244653 7:76358921-76358943 CAGCTGAGGCGGCGGCTGCGCGG + Exonic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1028762314 7:94509848-94509870 GAGCAGCGGCGGCGGGGCTGGGG + Exonic
1029123113 7:98281505-98281527 GTGCAGAGGCGCCGCCGGCGGGG + Intronic
1029123188 7:98281717-98281739 GGGACGCGGCGGCGGCGGCGGGG - Exonic
1029238812 7:99144079-99144101 CGGCAGCGGCGGAAGCGGCGAGG - Exonic
1029281563 7:99438956-99438978 CGGCGGCGGCGGCGGCGGCGAGG + Intronic
1029390587 7:100271701-100271723 GCGAAGCGGCGGCGGGGGCGGGG + Intronic
1029390588 7:100271704-100271726 AAGCGGCGGCGGGGGCGGGGCGG + Intronic
1029425837 7:100493653-100493675 GGGCAGAGGCAGCGGCAGCGCGG - Exonic
1029438768 7:100576213-100576235 GAGCAGAGGCGGGAGCTGCGTGG - Intronic
1029456207 7:100673813-100673835 CGGCGGCGGCGGCGGCGGCGCGG - Exonic
1029640539 7:101816757-101816779 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1029730127 7:102433488-102433510 CAGCGGCTGCGGCGGCCGCGGGG + Intronic
1029896399 7:103989353-103989375 CGGCGGCGGCGGCGGCGGCATGG - Exonic
1030033302 7:105388466-105388488 GAGGGGCGGCGGCGGGGGAGGGG - Intronic
1030049039 7:105522014-105522036 GAGGAGCCCCGGCGGCCGCGGGG + Intronic
1030049040 7:105522017-105522039 GAGCCCCGGCGGCCGCGGGGAGG + Intronic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1030138702 7:106284567-106284589 GGCGCGCGGCGGCGGCGGCGCGG - Intronic
1030820727 7:114087628-114087650 CGGCGGCGGCGCCGGCGGCGCGG + Intronic
1031043467 7:116862655-116862677 GAGTCGCGGGGGCGACGGCGCGG + Intronic
1031361978 7:120857965-120857987 AGGCGGCGACGGCGGCGGCGGGG - Exonic
1031531865 7:122886178-122886200 GCGCGCGGGCGGCGGCGGCGCGG - Exonic
1032074534 7:128830241-128830263 GGGGAGGGGCGGCGGGGGCGGGG + Intergenic
1032391253 7:131556670-131556692 GAGGGGCGGGGGCGGGGGCGGGG - Intronic
1032525590 7:132576748-132576770 GAGCAGCGGCGGCGGCTCTCGGG + Exonic
1033099979 7:138461132-138461154 CAGCGGCGGCGGCGGCGGCGCGG - Intronic
1033288602 7:140062708-140062730 GAGCGGCTGCTGCGGCAGCGTGG - Exonic
1033311752 7:140266784-140266806 GAGCTGCGGCGGCGGTGGAGGGG - Intergenic
1033477197 7:141702223-141702245 GGGCGGCGGCGGCGTTGGCGCGG - Intergenic
1033654318 7:143362670-143362692 GAGCGGCTGGGGCGGCGGCGCGG - Exonic
1034192720 7:149224068-149224090 GGGCGGTGGGGGCGGCGGCGCGG + Exonic
1034243129 7:149624672-149624694 GAGCAGCGGCGGCAGAGACAGGG - Intergenic
1034296580 7:149978189-149978211 GAGCAGTGGCAGCGGAGGCCAGG + Intergenic
1034306280 7:150047662-150047684 CGGCGGCGGCGGCGGCGGCGCGG - Intergenic
1034441060 7:151086355-151086377 CAGGAGGGGCGGGGGCGGCGGGG + Intronic
1034441061 7:151086358-151086380 GAGGGGCGGGGGCGGCGGGGAGG + Intronic
1034455403 7:151167491-151167513 CAACGGCGGGGGCGGCGGCGGGG - Exonic
1034483543 7:151341739-151341761 CGACAGCGGCGGCGGGGGCGGGG + Exonic
1034800566 7:154052988-154053010 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1034809451 7:154118642-154118664 GAGCAGTGGCAGCGGAGGCCAGG - Intronic
1035168598 7:157005765-157005787 GAAGGGCGGCGGCGGGGGCGCGG - Exonic
1035169564 7:157010032-157010054 GGGCGGCGGCGGCGGCGGCACGG - Exonic
1035169605 7:157010203-157010225 AGGTGGCGGCGGCGGCGGCGGGG - Exonic
1035395743 7:158533887-158533909 GAGCAGCTGTGACGGCGGCACGG - Intronic
1035579545 8:731407-731429 GGGCTGCGGGGGCGGCGGTGCGG + Intronic
1036561440 8:9903289-9903311 GCGCAGCGGCCGCGGGCGCGAGG - Intergenic
1036789497 8:11708660-11708682 CAGCGGCGGCGGCGGCCGCCAGG - Exonic
1036910627 8:12754872-12754894 GGCCAGAGGCGGCGGCCGCGGGG + Exonic
1037529218 8:19757329-19757351 CAGCGGCGGCGGCGGCGGCTCGG + Intronic
1037769189 8:21789074-21789096 CTGCAGCGGCGGCGGCGACAAGG + Intronic
1037769203 8:21789118-21789140 TGGCGGCGGCGGCGGCGCCGGGG + Intronic
1039467837 8:37796845-37796867 GACCGGCGGCGGGAGCGGCGCGG + Intronic
1040014802 8:42691523-42691545 GAGGAACGGTGGCGGCGGCGAGG + Intergenic
1040038839 8:42896759-42896781 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1041124466 8:54621383-54621405 GAGCAGCGACGGCTACGGGGTGG - Exonic
1041689925 8:60678793-60678815 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1041690145 8:60679618-60679640 GAGCAGCGGCGGCGGCGGCTCGG + Intronic
1041839166 8:62248948-62248970 GAGCGGCGGCCGCGGGGCCGAGG + Exonic
1041910751 8:63086093-63086115 GGGCAGCGGCCGCAGAGGCGGGG - Intergenic
1041919831 8:63168975-63168997 CGGCAGCGGCGGCGACGGGGAGG - Intronic
1042040127 8:64581060-64581082 TGGCGGCGGCGGCGGCGGCGGGG + Exonic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042532859 8:69832990-69833012 CGGCGGCGGCGGCGGCGGAGGGG - Exonic
1042785093 8:72537379-72537401 CAGCGGCGGCGGCGGCCGCGGGG - Exonic
1043053343 8:75407903-75407925 GAGATGCGGCGGCGGCCGCGCGG + Intronic
1043769722 8:84183352-84183374 AGGCGGCGGCGGCGGCGACGGGG - Intronic
1044242433 8:89902644-89902666 GGGCAGCCGCGGCAACGGCGAGG + Exonic
1044306354 8:90645605-90645627 GAGTGGCGGCGGCGGCGTGGTGG - Exonic
1044306355 8:90645608-90645630 CGGGAGTGGCGGCGGCGGCGTGG - Exonic
1044692899 8:94896269-94896291 GCGCGCTGGCGGCGGCGGCGGGG - Intronic
1044698802 8:94948895-94948917 TGACAGAGGCGGCGGCGGCGCGG - Intronic
1045098773 8:98825461-98825483 AAGCGGCGCCGGCGGCCGCGGGG - Intronic
1045516292 8:102863625-102863647 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1045583224 8:103500817-103500839 TGGCAGCGGCGGCACCGGCGCGG - Intronic
1046547418 8:115669074-115669096 GCGGGGCGGCGGCGGCGGCGCGG - Intronic
1046659968 8:116938488-116938510 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1047024555 8:120811811-120811833 CGGCGGCGGCGGCGGCGGCTGGG - Exonic
1047381878 8:124372079-124372101 GGGGCGCGGCGGCGGCGGCCGGG + Exonic
1048214123 8:132480457-132480479 GGGCGGCGGAGGCGGCGGGGCGG - Exonic
1048981176 8:139703928-139703950 GCGCGGCGGCGGCGGCGGGAGGG + Intergenic
1049145971 8:141001240-141001262 CGGCGGCGGCGGCGGCGGCGCGG + Intronic
1049194519 8:141308112-141308134 GGGCCGCGGGGGCGGCGGGGCGG + Intronic
1049287200 8:141782288-141782310 GAGCAACAGCGGCTGCGGTGGGG - Intergenic
1049405436 8:142450073-142450095 CAGCAGCGGCCCCGCCGGCGAGG - Exonic
1049417129 8:142500326-142500348 GAGGAGCGGCGCGGGGGGCGGGG - Intronic
1049419587 8:142510877-142510899 GCGGAGCGTCAGCGGCGGCGGGG - Intronic
1049460912 8:142727325-142727347 TAGCGGCGGCGGCGGGCGCGGGG - Exonic
1049532241 8:143160348-143160370 GAGCCGGGGCGGGGGCCGCGCGG + Intronic
1049585303 8:143430163-143430185 CACCGGCGGCGGCGGCGGCGCGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049689786 8:143953447-143953469 CGGCGGCGGCGGCGGCGGCGGGG - Intronic
1049746960 8:144267086-144267108 AGGCGGCGGGGGCGGCGGCGGGG - Exonic
1049762070 8:144336251-144336273 GAGGAGCGGCGGAGGCAGCGCGG + Exonic
1049811912 8:144579452-144579474 GAGCAGCGGAGGCTCGGGCGTGG - Intronic
1049891269 9:73092-73114 GAGAGGGCGCGGCGGCGGCGCGG + Intergenic
1050090751 9:2015451-2015473 GAGCGGCGGCTGCAGCGGGGCGG - Intronic
1051146201 9:14030195-14030217 GAGCAGCAGCGGGGGGGGGGGGG + Intergenic
1051170563 9:14315350-14315372 AAGAGGCGGCGGCGGCGGCTCGG - Intronic
1051287426 9:15510935-15510957 CGGCGGCGGCAGCGGCGGCGCGG - Exonic
1051665645 9:19464977-19464999 GGGCTGCGGCGGGGGCGGCCAGG + Intergenic
1052192789 9:25678177-25678199 CAGCGGCGGCGGCGGCGGCGTGG - Exonic
1052888939 9:33677382-33677404 CGGCGGCGGCGGCGGCGGCCCGG - Intergenic
1053050675 9:34958404-34958426 AAGCGGGGGCGGGGGCGGCGGGG + Intronic
1053072905 9:35111533-35111555 GGGCAGTGGAGTCGGCGGCGCGG - Exonic
1053138277 9:35665241-35665263 GAGCCGCGGAGGCGGGGCCGGGG + Exonic
1053240025 9:36487690-36487712 AAGCGGCGGCGGCGGCGGAGGGG + Intergenic
1053372725 9:37576239-37576261 GGGCACCGGCGGCCGCGGCCCGG - Exonic
1053690426 9:40584158-40584180 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1053690490 9:40584409-40584431 GGGCGGCGGCGGCGGCGCGGCGG - Intergenic
1053690491 9:40584412-40584434 GGCGGGCGGCGGCGGCGGCGCGG - Intergenic
1053697400 9:40650739-40650761 GGGCGGGGGCCGCGGCGGCGGGG + Intergenic
1053697453 9:40650917-40650939 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1053697505 9:40651092-40651114 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1053697560 9:40651309-40651331 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1053697601 9:40651436-40651458 AAGCCGTGGCGGCGGCGGGGGGG + Intergenic
1053697632 9:40651545-40651567 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054274363 9:63053249-63053271 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1054301678 9:63385119-63385141 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054308705 9:63450185-63450207 GGGCGGGGGCCGCGGCGGCGGGG + Intergenic
1054308742 9:63450317-63450339 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054308797 9:63450501-63450523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1054308852 9:63450718-63450740 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054308894 9:63450845-63450867 AAGCCGTGGCGGCGGCGGGGGGG + Intergenic
1054308924 9:63450953-63450975 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054400461 9:64711680-64711702 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054407428 9:64774077-64774099 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054407465 9:64774209-64774231 AAAAAGCTGCGGCGGCGGCGGGG + Intergenic
1054407483 9:64774277-64774299 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054407536 9:64774433-64774455 AAGCCGCGGCGGCGGGGGGGGGG + Intergenic
1054407655 9:64774848-64774870 CGGCGGCTGCGGCGGCGGCGGGG + Intergenic
1054434051 9:65195936-65195958 GCACAGCGGCGGCGCAGGCGCGG - Intergenic
1054440791 9:65258668-65258690 AAGCCGTGGCGGCGGCGGGGGGG + Intergenic
1054440853 9:65258890-65258912 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1054440856 9:65258893-65258915 AAGCCGCGGCGGCGGCGGGGGGG + Intergenic
1054489421 9:65762594-65762616 AAGCCGCGGCGGCGGCGGGGGGG - Intergenic
1054489424 9:65762597-65762619 AAAAAGCCGCGGCGGCGGCGGGG - Intergenic
1054496336 9:65825732-65825754 GCACAGCGGCGGCGCAGGCGCGG + Intergenic
1054731341 9:68705295-68705317 GAGCAGCAGCGGCGCCCGCCGGG - Intergenic
1054842667 9:69760054-69760076 CGGCGGCGGCCGCGGCGGCGGGG - Intergenic
1055091119 9:72365284-72365306 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1055514158 9:77020142-77020164 GGGCGGCGGCGGCGGCGGCTGGG - Exonic
1055611779 9:78031585-78031607 CGGCGGCGGCGGCGGCGGCTCGG - Intergenic
1056386282 9:86099588-86099610 GAGCAGCGCCGGCGGCGCGAAGG + Intronic
1056475070 9:86945807-86945829 CAGCGGCGGCGGCGGCCGCTTGG - Exonic
1056475395 9:86947231-86947253 CGGCGGCGGTGGCGGCGGCGAGG - Intergenic
1056659697 9:88534944-88534966 GCGCAGTGGGGGCGGGGGCGGGG + Intergenic
1057314166 9:93958361-93958383 CAAAAACGGCGGCGGCGGCGGGG + Intergenic
1057547259 9:96027604-96027626 GGGCGGCGGCGGCGCCGGCCTGG - Intergenic
1057773162 9:97984464-97984486 GTGCCGCGGCGGCGGCGCCCGGG + Intronic
1057869710 9:98708687-98708709 TGGCGGCGGCGGCGGCGGCCCGG + Exonic
1057869885 9:98709256-98709278 GCGCTGCGGCGGCCGCGGGGAGG + Intergenic
1058484850 9:105433615-105433637 AAGCAGGGGCGGCGGGGGAGTGG - Intronic
1058504757 9:105656219-105656241 AGGCGGCGGCGGCGGCGGCGCGG + Intergenic
1059375226 9:113876156-113876178 CGGCAGCGGCTGCCGCGGCGCGG + Intergenic
1059453654 9:114386669-114386691 GAGCAGGGGCAGTGGCGGCTTGG - Intronic
1059483716 9:114611539-114611561 CGGCGGCGGCGGCGGCGGCGCGG + Exonic
1059633936 9:116154342-116154364 CGGCGGCGGCGGCGGCGGCGAGG - Exonic
1060223959 9:121780335-121780357 GAGGAGCGGTGGTGGCGGGGGGG - Intronic
1060468703 9:123930051-123930073 TGGAGGCGGCGGCGGCGGCGAGG - Exonic
1060468739 9:123930174-123930196 GGGCAGCGGCGGCGGCAGCGCGG - Intergenic
1060555349 9:124504910-124504932 GAGCGGCCCCGGCGGCGGTGCGG - Intronic
1060566773 9:124599585-124599607 GCGCGGCGGCGGCGGCCGCTCGG + Intronic
1060584424 9:124777284-124777306 GAGCAGCGGCCGGGGCGGGAGGG - Exonic
1060700751 9:125747379-125747401 CGGCGGCGGCGGCGGCGACGAGG - Intronic
1060770175 9:126326816-126326838 CGGCGGCGGCGGCGGCGGAGGGG - Intergenic
1060821757 9:126665307-126665329 GGGCTGGGGCGGCGGGGGCGGGG + Intronic
1060916929 9:127397400-127397422 GGGCAGCGGCGAAGGCGGCGAGG - Exonic
1060979885 9:127785875-127785897 TAGTGGCGGCGGCGGAGGCGGGG + Intronic
1061052243 9:128203715-128203737 GTGCAGCGTCGGGGGCTGCGAGG - Intronic
1061196659 9:129110566-129110588 CAGCCGCGGCGGCGGCGGCGCGG - Exonic
1061207672 9:129174119-129174141 GAGGCTCGGCGGAGGCGGCGGGG - Intergenic
1061208312 9:129176910-129176932 GAGCGGCGGCGGCTGCTCCGAGG + Exonic
1061208441 9:129177386-129177408 GAGAAGCGGCGGCGGCCGGAGGG + Exonic
1061272257 9:129550177-129550199 GAAAGGCTGCGGCGGCGGCGCGG - Intergenic
1061321825 9:129835638-129835660 GAGGGGCGGCGGCGGCCGGGGGG - Intronic
1061438152 9:130579652-130579674 CGGCGGCGGCGACGGCGGCGGGG + Exonic
1061610039 9:131740024-131740046 GGGGAGCGGCGGCGGGCGCGCGG - Intronic
1061726091 9:132582726-132582748 GGGCAGGGGCAGCGGCGGCTGGG + Exonic
1061726955 9:132587276-132587298 GGGCACCGGCGGCGGCTGCGAGG + Intronic
1061802766 9:133121191-133121213 GCGCGGCGGGGGCGGCGGCGCGG + Intronic
1061961851 9:133992636-133992658 CAGGAGCCGCGGCGGCCGCGGGG - Intergenic
1062022522 9:134326236-134326258 GCGGGGCGGCGGCGGCGGAGGGG + Intronic
1062022557 9:134326353-134326375 GCGCTGCGGCGCCGGCGGGGGGG - Intronic
1062084618 9:134642237-134642259 CAGCAGCGGGGGCAGCAGCGGGG - Exonic
1062162472 9:135087834-135087856 GGGCGGCGGCGGCGGCGGGCGGG + Exonic
1062337556 9:136078966-136078988 GGAGAGGGGCGGCGGCGGCGCGG - Intronic
1062558713 9:137129598-137129620 AAGCAGCGGCGGCGGATGCGTGG + Intergenic
1062574565 9:137200220-137200242 GGGCGGCGGCGGCGGCGGCGGGG + Exonic
1062592656 9:137281119-137281141 CTGCAGCGGGGCCGGCGGCGGGG - Exonic
1062659100 9:137619089-137619111 GGGCAGCGGCGGAGGCGGCGCGG + Intronic
1062659130 9:137619172-137619194 CAGCGGCGGCGGCGGCGGCGGGG - Intronic
1202779804 9_KI270717v1_random:24230-24252 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1202779853 9_KI270717v1_random:24389-24411 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1202779908 9_KI270717v1_random:24606-24628 AAAAAGCCGCGGCGGCGGCGGGG + Intergenic
1202779948 9_KI270717v1_random:24732-24754 AAGCCGTGGCGGCGGCGGGGGGG + Intergenic
1203774027 EBV:62906-62928 CAGCAGCGGCGGTAGCGGAGGGG - Intergenic
1203469879 Un_GL000220v1:111682-111704 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203471023 Un_GL000220v1:115501-115523 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203477700 Un_GL000220v1:155654-155676 CCGCGGCGGCGGCGGCGGCGCGG - Intergenic
1203478844 Un_GL000220v1:159473-159495 CGGCGGCGGCGGCGGCGGCGGGG + Intergenic
1203613065 Un_KI270749v1:27382-27404 AAGCCGCGGCGTCGGGGGCGGGG - Intergenic
1185641539 X:1591724-1591746 GGCCAGCGGCGGCGGCGGCCTGG + Exonic
1185736647 X:2500937-2500959 GCGCGGAAGCGGCGGCGGCGCGG - Exonic
1186395767 X:9207364-9207386 GGGAAGTGGCGGAGGCGGCGGGG - Intergenic
1186426091 X:9465202-9465224 GCGCTGCGGCGGCGGCGGGGCGG - Exonic
1187181451 X:16946929-16946951 CAGCAGCAGCGGCGGCGGCCCGG - Exonic
1187419545 X:19122534-19122556 GAGCGGCGGGGGCGGCGCCGAGG - Exonic
1187518142 X:19990921-19990943 CGGCGGCGGCGGCGGCGGCGGGG - Intergenic
1188003525 X:25002645-25002667 GGCCGGCGGCGGCGGCGGCGTGG + Intergenic
1188004083 X:25005488-25005510 GAAGGGCGGCCGCGGCGGCGCGG - Intronic
1188314788 X:28659580-28659602 GAGCGACGGTGGCGGTGGCGCGG + Intronic
1189010751 X:37043648-37043670 GGGCAGTGGCGGCAGCGGTGGGG + Intergenic
1189035652 X:37491907-37491929 GGGCAGTGGCGGCAGCGGCGGGG - Intronic
1189310435 X:40014123-40014145 CAGGAGAGGCGGCGACGGCGGGG - Intergenic
1189324595 X:40105100-40105122 CAGCAGCGGCGGCGGCGGCGAGG + Intronic
1189324596 X:40105103-40105125 CAGCGGCGGCGGCGGCGAGGAGG + Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1189324664 X:40105333-40105355 TGACTGCGGCGGCGGCGGCGGGG - Intronic
1189821479 X:44873366-44873388 AGGCGGCGGCGGCGGCGGCAGGG - Intronic
1190008062 X:46758964-46758986 CAGCCGCGGCGGCGGCGCCCCGG + Exonic
1190712929 X:53082575-53082597 CGGCGGCGGCGGCGGCGGCGGGG - Exonic
1190789256 X:53683957-53683979 TAGCCGCGGAGGCGGCGGCAAGG - Exonic
1192034375 X:67546547-67546569 CGGCGGCGGCGGCGGCGGCGAGG + Exonic
1192361761 X:70445135-70445157 TGGCGGCGGTGGCGGCGGCGTGG + Exonic
1192705550 X:73526116-73526138 GAGCGGCGGCTGCGGCTCCGGGG - Intergenic
1194421056 X:93673377-93673399 GAGTGGCGGCGGCGGAGGCCCGG + Exonic
1195022299 X:100841779-100841801 GAGAGGAGGAGGCGGCGGCGCGG - Intergenic
1195716840 X:107826301-107826323 TAGCGGCGGCGGCGGCGACCGGG + Exonic
1195923184 X:110002676-110002698 GCGCCGCGGCGGCGGCCGCCAGG + Intronic
1195954792 X:110317828-110317850 GGGCTGCGGCGGCGGCGGCGGGG - Exonic
1196031077 X:111096314-111096336 GGGCTGCGGCTGCGGCCGCGGGG + Intronic
1196791592 X:119469129-119469151 CGGCAGCGGCCGCGGCTGCGCGG - Intronic
1196808028 X:119605916-119605938 CGGCAGCGGCGGCGGCGGGAGGG + Intergenic
1196886516 X:120251148-120251170 GAGCCGCGAGGGCCGCGGCGCGG + Intronic
1197415263 X:126165963-126165985 CGGCGGCGGCGGCGGCGGCCCGG + Intergenic
1198388137 X:136147716-136147738 CCCGAGCGGCGGCGGCGGCGGGG - Intronic
1198533581 X:137566823-137566845 CGGCGGCGGCGGCGGCGGCGTGG - Exonic
1198534501 X:137573753-137573775 GGGCCGGGGCGGAGGCGGCGAGG + Intronic
1198767096 X:140091345-140091367 CGGCGGCGGCGGCGGCGGCTGGG + Intergenic
1199445121 X:147912093-147912115 CGGCGGCGGCGGCGGCGGCTGGG + Exonic
1199500383 X:148500722-148500744 CAGCGGCGGCGGGGGCGGCCGGG - Exonic
1199500387 X:148500731-148500753 CGGCGGCGGCAGCGGCGGCGGGG - Exonic
1199772493 X:150983724-150983746 CAGCTGCGGCTGCGGCGGCTGGG + Intronic
1200003192 X:153072525-153072547 GCGCCGCTGCGGCGGCGGCGGGG - Exonic
1200004531 X:153077484-153077506 GCGCCGCTGCGGCGGCGGCGGGG + Intergenic
1200047696 X:153411448-153411470 GGGCCGGGGCGGCGGCAGCGTGG - Intergenic
1200058740 X:153474700-153474722 GAGAGGCGGGGGCGGGGGCGGGG + Intronic
1200093812 X:153648003-153648025 GAGCAGGAGCCGCGGCCGCGGGG - Exonic
1200100661 X:153688028-153688050 TGGCGGCGGCGGCGGCGGCTCGG - Intronic
1200126814 X:153819104-153819126 GCGCCGCGACGGCGGCGGGGTGG + Intronic
1200138503 X:153886161-153886183 CAGCAGCGGCTGTGGCGGGGCGG + Intronic
1200178699 X:154137035-154137057 GGTGAGCGGCGGCGGCGGCTCGG - Intergenic
1200292505 X:154886398-154886420 GGGCGGCGGCGGCGCCGGCCCGG + Exonic
1200339349 X:155382138-155382160 GGGCGGCGGCGGCGCCGGCCCGG + Exonic
1200347121 X:155458555-155458577 GGGCGGCGGCGGCGCCGGCCCGG - Exonic
1201232642 Y:11879764-11879786 CAGCAGCTGCGGAGGCTGCGTGG - Intergenic