ID: 1176029829

View in Genome Browser
Species Human (GRCh38)
Location 20:63006595-63006617
Sequence GCCCGGAGTGCCGTAGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176029815_1176029829 26 Left 1176029815 20:63006546-63006568 CCTGAGCTGGGGCGCGAGGTGCA 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 60
1176029822_1176029829 -1 Left 1176029822 20:63006573-63006595 CCGCGGGGAGGTCGCCGCCCGGG 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 60
1176029814_1176029829 29 Left 1176029814 20:63006543-63006565 CCGCCTGAGCTGGGGCGCGAGGT 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG 0: 1
1: 0
2: 0
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176029829 Original CRISPR GCCCGGAGTGCCGTAGCCGC GGG Exonic
901024508 1:6271966-6271988 GCACGGAGTGCCGTGGTCCCGGG + Intronic
904718201 1:32485166-32485188 GCCCGAAGCGCCGCAGCCCCTGG - Exonic
919892040 1:201982705-201982727 GCGCGGAGTGCAGCGGCCGCCGG - Exonic
1071532353 10:86400197-86400219 TCCCGCAGGGCCGCAGCCGCGGG - Intergenic
1073057222 10:100710387-100710409 GCCTGGGGCGCCCTAGCCGCTGG + Intergenic
1074065363 10:110008226-110008248 GCCCGGGCTGCAGCAGCCGCCGG - Exonic
1075616284 10:123892527-123892549 GCCTGGAGAGCAGAAGCCGCAGG - Intronic
1081773996 11:45665497-45665519 ACCCGGAGCGCCGCAGCCCCGGG + Exonic
1081863606 11:46347794-46347816 GCCCGAAGAGCCGCAGCCCCGGG - Intronic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1089646652 11:119884795-119884817 GCCCGGTGTGCCTCAGCCTCGGG + Intergenic
1107787107 13:43968558-43968580 GCCCGAAGAGCCGCAGCCCCGGG - Intergenic
1119086422 14:71743544-71743566 GCCCGCAGTGTTGTAGCCACAGG + Intergenic
1121691027 14:95877088-95877110 ACCCGGAGCGCCGGAGCCGCAGG - Intergenic
1122145082 14:99684192-99684214 GCCCGGAGCGCCGGAGCCGGAGG + Intergenic
1122542686 14:102506913-102506935 GCCCGGAGCACCCTAGGCGCTGG - Exonic
1125471704 15:40010892-40010914 GGCAGATGTGCCGTAGCCGCAGG - Intronic
1132544660 16:527748-527770 CCCGGGCGCGCCGTAGCCGCGGG + Intronic
1133026066 16:2989477-2989499 GCCCGGGGTGCTGGAGCAGCTGG - Intergenic
1137057486 16:35752574-35752596 GCCCCTAGCGCCGTAGCAGCAGG + Intergenic
1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG + Intergenic
1138588055 16:57984591-57984613 GCCCGCGCGGCCGTAGCCGCAGG - Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142290615 16:89192263-89192285 GCCCCGAGTCCCGGAGCAGCAGG - Exonic
1143434580 17:6914218-6914240 GCCGTGAGTGCGGAAGCCGCGGG + Intronic
1146568206 17:33931279-33931301 GCCCGCAGTCACGTACCCGCTGG - Intronic
1147961591 17:44170887-44170909 CCCAGCAGTGCCGGAGCCGCAGG + Exonic
1151850149 17:76685190-76685212 GCCAGGAGTGCTGTAGAGGCTGG + Intronic
1152083086 17:78200625-78200647 GACTGGAGTGACGTAGCCCCAGG + Intronic
1154165911 18:12014345-12014367 CCCCGGAGACCCGGAGCCGCTGG - Exonic
1155995105 18:32322869-32322891 GACCGCAGTGCCGTAACAGCTGG + Intronic
1157544799 18:48539865-48539887 GCCCCGAGTGCCGCAGCCCCCGG - Intronic
1160204772 18:76823084-76823106 GCCCGGGGCGCGGTATCCGCAGG - Intronic
1163548311 19:17951913-17951935 GCCCGGAGAGCGGAAGCCCCTGG - Intronic
931301256 2:60980511-60980533 GCACAGAGTTCCGTAGCCACAGG - Intronic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
947401503 2:229735719-229735741 GCCCTGAGTGCAGTAGCCTGCGG - Intergenic
948116012 2:235494589-235494611 GCCCGGGGCGCCGCAGCCCCCGG - Exonic
948482765 2:238260912-238260934 GCCCAGACTCCCGTAGCCACTGG + Exonic
1172364001 20:34334962-34334984 GCCCTGAGTTCAGTAGCAGCTGG + Intergenic
1174053786 20:47785043-47785065 GCTCGGTGTGCCGTGTCCGCGGG + Intronic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
1176253352 20:64137741-64137763 GCCCGGAGTCAGGCAGCCGCAGG + Intergenic
1179674739 21:42974114-42974136 GCCGGGCGTCCCGTAGCCGAAGG - Intergenic
1183201178 22:36387022-36387044 GCCCGGAATGCAGCAGCCGTCGG - Intronic
1184285064 22:43465865-43465887 GCAGGGAGTGCAGTAGCCCCTGG + Intronic
1185254340 22:49823982-49824004 GGCCGGCGTGCCGTGGGCGCTGG + Exonic
1185291140 22:50028435-50028457 GCCCTGCGGGCCATAGCCGCGGG + Intronic
962273676 3:133996477-133996499 CTCCGGAATGCCGTAGCCTCAGG - Intronic
968010536 3:195271221-195271243 GCCGGGCGTGCCGAAACCGCTGG + Intergenic
981941179 4:150283063-150283085 GCCCACAGTGCCGTGGCCGTTGG - Intronic
985129320 4:186724750-186724772 GCCCGGAGGGCCGGAGGCGCTGG + Intronic
985542601 5:493815-493837 GCCCGGAGTGGGGGAGCCGTCGG - Intronic
1004705866 6:18123000-18123022 GCCCGGACAGCCGTAGCACCCGG - Intergenic
1008030400 6:46688140-46688162 GCCCGGAATGCCGGCGCCGGGGG + Exonic
1009975677 6:70668197-70668219 GCCCCGAGCGCCGCAGCGGCGGG - Intronic
1017929408 6:158939173-158939195 GGCCGCAGTGCCGGGGCCGCAGG - Intergenic
1019593438 7:1847284-1847306 GCCAGGACTGCAGGAGCCGCTGG + Exonic
1024579848 7:50793028-50793050 GCCCGGGGCGCCGGAGCCCCCGG + Intronic
1035234096 7:157485098-157485120 GCCCGGAGTGTCTTAGCACCTGG + Intergenic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049218242 8:141417547-141417569 GTCCGGAGGGCAGGAGCCGCCGG - Intronic
1049721030 8:144115646-144115668 GCCCGGAGAGCCGCCGCCGCTGG + Exonic
1049774555 8:144398384-144398406 GCCCTGAGTGGCGAAGCCACTGG + Exonic
1059102595 9:111484250-111484272 GCCCGGGCTGCCCTAGCGGCCGG + Exonic
1060971840 9:127742790-127742812 GCGGGGAGTGCGGTAGCCGGGGG + Intronic
1062318379 9:135978897-135978919 GCCCGGGGTTCCGTCTCCGCTGG - Intergenic
1192762240 X:74105467-74105489 CCGCGGAGGGCCGTAGCCGCAGG + Intergenic