ID: 1176030386

View in Genome Browser
Species Human (GRCh38)
Location 20:63008648-63008670
Sequence CACCGGCAGCAGTGCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030386_1176030397 7 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030397 20:63008678-63008700 GGGCTGCGGGGCCTCCTCCTGGG No data
1176030386_1176030399 20 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030399 20:63008691-63008713 TCCTCCTGGGCCTGAACTGCAGG No data
1176030386_1176030405 29 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030405 20:63008700-63008722 GCCTGAACTGCAGGGCTGGTGGG No data
1176030386_1176030403 25 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030403 20:63008696-63008718 CTGGGCCTGAACTGCAGGGCTGG No data
1176030386_1176030396 6 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030396 20:63008677-63008699 GGGGCTGCGGGGCCTCCTCCTGG No data
1176030386_1176030391 -7 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030391 20:63008664-63008686 GCCGGTGCGGTCCGGGGCTGCGG No data
1176030386_1176030407 30 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030407 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
1176030386_1176030404 28 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030404 20:63008699-63008721 GGCCTGAACTGCAGGGCTGGTGG No data
1176030386_1176030394 -5 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030394 20:63008666-63008688 CGGTGCGGTCCGGGGCTGCGGGG No data
1176030386_1176030393 -6 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030393 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
1176030386_1176030401 21 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030401 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030386 Original CRISPR CACCGGCAGCAGTGCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr