ID: 1176030392

View in Genome Browser
Species Human (GRCh38)
Location 20:63008665-63008687
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030392_1176030411 22 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030411 20:63008710-63008732 CAGGGCTGGTGGGGGCCATGGGG No data
1176030392_1176030404 11 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030404 20:63008699-63008721 GGCCTGAACTGCAGGGCTGGTGG No data
1176030392_1176030399 3 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030399 20:63008691-63008713 TCCTCCTGGGCCTGAACTGCAGG No data
1176030392_1176030401 4 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030401 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
1176030392_1176030410 21 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030410 20:63008709-63008731 GCAGGGCTGGTGGGGGCCATGGG No data
1176030392_1176030414 30 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030414 20:63008718-63008740 GTGGGGGCCATGGGGGAAGGTGG No data
1176030392_1176030413 27 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030392_1176030405 12 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030405 20:63008700-63008722 GCCTGAACTGCAGGGCTGGTGGG No data
1176030392_1176030403 8 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030403 20:63008696-63008718 CTGGGCCTGAACTGCAGGGCTGG No data
1176030392_1176030397 -10 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030397 20:63008678-63008700 GGGCTGCGGGGCCTCCTCCTGGG No data
1176030392_1176030407 13 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030407 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
1176030392_1176030409 20 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030409 20:63008708-63008730 TGCAGGGCTGGTGGGGGCCATGG No data
1176030392_1176030412 23 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG No data
1176030392_1176030408 14 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030408 20:63008702-63008724 CTGAACTGCAGGGCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030392 Original CRISPR CCCGCAGCCCCGGACCGCAC CGG (reversed) Intergenic
No off target data available for this crispr