ID: 1176030397

View in Genome Browser
Species Human (GRCh38)
Location 20:63008678-63008700
Sequence GGGCTGCGGGGCCTCCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030382_1176030397 25 Left 1176030382 20:63008630-63008652 CCGTGGCCATTCGGAGAGCCACT No data
Right 1176030397 20:63008678-63008700 GGGCTGCGGGGCCTCCTCCTGGG No data
1176030384_1176030397 19 Left 1176030384 20:63008636-63008658 CCATTCGGAGAGCCACTCTGGCA No data
Right 1176030397 20:63008678-63008700 GGGCTGCGGGGCCTCCTCCTGGG No data
1176030386_1176030397 7 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030397 20:63008678-63008700 GGGCTGCGGGGCCTCCTCCTGGG No data
1176030392_1176030397 -10 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030397 20:63008678-63008700 GGGCTGCGGGGCCTCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030397 Original CRISPR GGGCTGCGGGGCCTCCTCCT GGG Intergenic
No off target data available for this crispr