ID: 1176030399

View in Genome Browser
Species Human (GRCh38)
Location 20:63008691-63008713
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030392_1176030399 3 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030399 20:63008691-63008713 TCCTCCTGGGCCTGAACTGCAGG No data
1176030395_1176030399 -7 Left 1176030395 20:63008675-63008697 CCGGGGCTGCGGGGCCTCCTCCT No data
Right 1176030399 20:63008691-63008713 TCCTCCTGGGCCTGAACTGCAGG No data
1176030386_1176030399 20 Left 1176030386 20:63008648-63008670 CCACTCTGGCACTGCTGCCGGTG No data
Right 1176030399 20:63008691-63008713 TCCTCCTGGGCCTGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030399 Original CRISPR TCCTCCTGGGCCTGAACTGC AGG Intergenic
No off target data available for this crispr