ID: 1176030400

View in Genome Browser
Species Human (GRCh38)
Location 20:63008692-63008714
Sequence CCCTGCAGTTCAGGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030400_1176030422 28 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030422 20:63008743-63008765 CCACAGGTCCCCGGAGCTGGGGG No data
1176030400_1176030418 25 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030418 20:63008740-63008762 GCTCCACAGGTCCCCGGAGCTGG No data
1176030400_1176030411 -5 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030411 20:63008710-63008732 CAGGGCTGGTGGGGGCCATGGGG No data
1176030400_1176030419 26 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030419 20:63008741-63008763 CTCCACAGGTCCCCGGAGCTGGG No data
1176030400_1176030413 0 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030400_1176030409 -7 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030409 20:63008708-63008730 TGCAGGGCTGGTGGGGGCCATGG No data
1176030400_1176030410 -6 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030410 20:63008709-63008731 GCAGGGCTGGTGGGGGCCATGGG No data
1176030400_1176030417 19 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030417 20:63008734-63008756 AAGGTGGCTCCACAGGTCCCCGG No data
1176030400_1176030412 -4 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030412 20:63008711-63008733 AGGGCTGGTGGGGGCCATGGGGG No data
1176030400_1176030416 12 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030416 20:63008727-63008749 ATGGGGGAAGGTGGCTCCACAGG No data
1176030400_1176030414 3 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030414 20:63008718-63008740 GTGGGGGCCATGGGGGAAGGTGG No data
1176030400_1176030420 27 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030420 20:63008742-63008764 TCCACAGGTCCCCGGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030400 Original CRISPR CCCTGCAGTTCAGGCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr