ID: 1176030406

View in Genome Browser
Species Human (GRCh38)
Location 20:63008701-63008723
Sequence CCCCACCAGCCCTGCAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030406_1176030414 -6 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030414 20:63008718-63008740 GTGGGGGCCATGGGGGAAGGTGG No data
1176030406_1176030419 17 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030419 20:63008741-63008763 CTCCACAGGTCCCCGGAGCTGGG No data
1176030406_1176030422 19 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030422 20:63008743-63008765 CCACAGGTCCCCGGAGCTGGGGG No data
1176030406_1176030426 28 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030426 20:63008752-63008774 CCCGGAGCTGGGGGAGCAGGAGG No data
1176030406_1176030420 18 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030420 20:63008742-63008764 TCCACAGGTCCCCGGAGCTGGGG No data
1176030406_1176030416 3 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030416 20:63008727-63008749 ATGGGGGAAGGTGGCTCCACAGG No data
1176030406_1176030417 10 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030417 20:63008734-63008756 AAGGTGGCTCCACAGGTCCCCGG No data
1176030406_1176030423 25 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030423 20:63008749-63008771 GTCCCCGGAGCTGGGGGAGCAGG No data
1176030406_1176030418 16 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030418 20:63008740-63008762 GCTCCACAGGTCCCCGGAGCTGG No data
1176030406_1176030413 -9 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030406 Original CRISPR CCCCACCAGCCCTGCAGTTC AGG (reversed) Intergenic