ID: 1176030408

View in Genome Browser
Species Human (GRCh38)
Location 20:63008702-63008724
Sequence CTGAACTGCAGGGCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030392_1176030408 14 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030408 20:63008702-63008724 CTGAACTGCAGGGCTGGTGGGGG No data
1176030395_1176030408 4 Left 1176030395 20:63008675-63008697 CCGGGGCTGCGGGGCCTCCTCCT No data
Right 1176030408 20:63008702-63008724 CTGAACTGCAGGGCTGGTGGGGG No data
1176030398_1176030408 -10 Left 1176030398 20:63008689-63008711 CCTCCTCCTGGGCCTGAACTGCA No data
Right 1176030408 20:63008702-63008724 CTGAACTGCAGGGCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030408 Original CRISPR CTGAACTGCAGGGCTGGTGG GGG Intergenic
No off target data available for this crispr