ID: 1176030413

View in Genome Browser
Species Human (GRCh38)
Location 20:63008715-63008737
Sequence CTGGTGGGGGCCATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030406_1176030413 -9 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030392_1176030413 27 Left 1176030392 20:63008665-63008687 CCGGTGCGGTCCGGGGCTGCGGG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030400_1176030413 0 Left 1176030400 20:63008692-63008714 CCTCCTGGGCCTGAACTGCAGGG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030402_1176030413 -3 Left 1176030402 20:63008695-63008717 CCTGGGCCTGAACTGCAGGGCTG No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030395_1176030413 17 Left 1176030395 20:63008675-63008697 CCGGGGCTGCGGGGCCTCCTCCT No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data
1176030398_1176030413 3 Left 1176030398 20:63008689-63008711 CCTCCTCCTGGGCCTGAACTGCA No data
Right 1176030413 20:63008715-63008737 CTGGTGGGGGCCATGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030413 Original CRISPR CTGGTGGGGGCCATGGGGGA AGG Intergenic
No off target data available for this crispr