ID: 1176030423

View in Genome Browser
Species Human (GRCh38)
Location 20:63008749-63008771
Sequence GTCCCCGGAGCTGGGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030406_1176030423 25 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030423 20:63008749-63008771 GTCCCCGGAGCTGGGGGAGCAGG No data
1176030415_1176030423 1 Left 1176030415 20:63008725-63008747 CCATGGGGGAAGGTGGCTCCACA No data
Right 1176030423 20:63008749-63008771 GTCCCCGGAGCTGGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030423 Original CRISPR GTCCCCGGAGCTGGGGGAGC AGG Intergenic
No off target data available for this crispr