ID: 1176030426

View in Genome Browser
Species Human (GRCh38)
Location 20:63008752-63008774
Sequence CCCGGAGCTGGGGGAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176030415_1176030426 4 Left 1176030415 20:63008725-63008747 CCATGGGGGAAGGTGGCTCCACA No data
Right 1176030426 20:63008752-63008774 CCCGGAGCTGGGGGAGCAGGAGG No data
1176030406_1176030426 28 Left 1176030406 20:63008701-63008723 CCTGAACTGCAGGGCTGGTGGGG No data
Right 1176030426 20:63008752-63008774 CCCGGAGCTGGGGGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176030426 Original CRISPR CCCGGAGCTGGGGGAGCAGG AGG Intergenic
No off target data available for this crispr