ID: 1176032313

View in Genome Browser
Species Human (GRCh38)
Location 20:63018469-63018491
Sequence GATACCAGCGCACCCCAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176032313_1176032314 10 Left 1176032313 20:63018469-63018491 CCGATTTGGGGTGCGCTGGTATC No data
Right 1176032314 20:63018502-63018524 TGATGCAGTGTCGTCCCGTCTGG No data
1176032313_1176032316 18 Left 1176032313 20:63018469-63018491 CCGATTTGGGGTGCGCTGGTATC No data
Right 1176032316 20:63018510-63018532 TGTCGTCCCGTCTGGGAACAAGG No data
1176032313_1176032315 11 Left 1176032313 20:63018469-63018491 CCGATTTGGGGTGCGCTGGTATC No data
Right 1176032315 20:63018503-63018525 GATGCAGTGTCGTCCCGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176032313 Original CRISPR GATACCAGCGCACCCCAAAT CGG (reversed) Intergenic
No off target data available for this crispr